Deletion of IL-1β exacerbates acrylamide-induced neurotoxicity in mice

Abstract

Acrylamide is a neurotoxicant in human and experimental animals. Interleukin-1β (IL-1β) is a proinflammatory cytokine known as a critical component of brain reaction to any insult or neurodegenerative pathologies, though its role in electrophile-induced neurotoxicity remains elusive. The aim of this study was to investigate the role of IL-1β in acrylamide-induced neurotoxicity in mice. Ten-week-old male wild-type and IL-1β knock-out mice were allocated into 3 groups each and exposed to acrylamide at 0, 12.5, 25 mg/kg body weight by oral gavage for 28 days. Compared with wild-type mice, the results showed a significant increase in landing foot spread test and a significant decrease in density of cortical noradrenergic axons in IL-1β KO mice exposed to acrylamide at 25 mg/kg body weight. Exposure to acrylamide at 25 mg/kg significantly increased cortical gene expression of Gclc, Gpx1, and Gpx4 in wild-type mice but decreased them in IL-1β KO mice. The same exposure level significantly increased total glutathione and oxidized glutathione (GSSG) in the cerebellum of wild-type mice but did not change total glutathione and decreased GSSG in the cerebellum of IL-1β KO mice. The basal level of malondialdehyde in the cerebellum was higher in IL-1β KO mice than in wild-type mice. The results suggest that IL-1β protects the mouse brain against acrylamide-induced neurotoxicity, probably through suppression of oxidative stress by glutathione synthesis and peroxidation. This unexpected result provides new insight on the protective role of IL-1β in acrylamide-induced neurotoxicity.

Acrylamide (C₃H₅NO) is a white, odorless, and water-soluble substance (Bin-Jumah et al., 2021), and an environmental electrophile commonly used in industry (Ruenz et al., 2016). Monomer acrylamide is used in the production of polymer compounds necessary for the manufacturing of plastic sheets, adhesive tapes, colors, and food packaging. Recent studies have also indicated that various cooking practices, such as roasting, baking, and frying, result in the production of significant amounts of acrylamide through Maillard reaction of reducing sugars and amino acids (Tareke et al., 2000, 2002). In addition to fried/baked potatoes, coffee and bakery products also contain substantial amounts of acrylamide (Bin-Jumah et al., 2021). Acrylamide is also used in water sanitation and production of flocculators, grouts, and press fabrics. The widespread use of acrylamide in industries translates into occupational exposure with potential negative health effects (Pennisi et al., 2013).

In humans and experimental animals, acrylamide is known to cause various neuropathies and encephalopathies (Erkekoğlu and Baydar, 2010; Spencer and Schaumburg, 1974). Previous reports described several cases of acrylamide exposure who presented with various neurological features ranging from numbness, leg weakness to unsteady movements. Based on these features, bioscientists and toxicologists focused on the issue of acrylamide neurotoxicity, especially acute occupational acrylamide intoxication in the construction, coal mining, flocculator manufacture, and tunnel building industries (Pennisi et al., 2013). These studies and more recent evidence from animal experiments suggest that neuroinflammation is potentially the underlying mechanism of acrylamide-induced neurotoxicity (Ekuban et al., 2021; Zong et al., 2019).

The triad of neurons, astrocytes, and microglia is crucial to brain function. Glial cells, including astrocytes and microglia, play a critical role in the central nervous system (CNS), which includes neurotrophic support, transporter regulation, pathogen clearance, promotion of neuronal development, and immune response modulation (Anderson and Swanson, 2000; Streit et al., 1988). Glial cells are rapidly activated in response to injury or infection to release neurotoxic signals, such as reactive oxygen species (ROS) and proinflammatory mediators (eg, IL-1, TNF-α, and IL-6 cytokines) (Li et al., 2014; Sloan and Barres, 2014).

CNS glia produce substantial amounts of inflammation-promoting interleukin-1beta (IL-1β), following tissue damage, stress, or illness. In the brain, IL-1β has a wide range of functions; it induces the synthesis of additional cytokines and growth factors by astrocytes and microglia, ultimately boosting brain inflammatory activity (Benveniste, 1992; Merrill and Benveniste, 1996). Our previous study found that acrylamide-induced neurotoxicity in the cerebral cortex of rats and BV-2 microglia cell line was associated with microglia activation and upregulation of proinflammatory cytokine genes (IL-1β and IL-18) (Zong et al., 2019). We also demonstrated that microglia activation and overexpression of proinflammatory cytokine genes (IL-1β, iNOS, TNF-α) accompanied greater acrylamide-induced sensorimotor impairment and degradation of noradrenergic and serotonergic axons in the prefrontal cortex of nuclear factor erythroid 2-related factor 2 (Nrf2)-null mice, compared with wild-type mice (Ekuban et al., 2021).

Nrf2 is a transcription factor involved in the process of oxidative stress. Once activated, Nrf2 is transferred to the nucleus, where it activates the transcription of downstream antioxidant protective genes. Nrf2 provides neuroprotection through enhancement and/or suppression of the expression of proinflammatory cytokines (Davuljigari et al., 2021; Ekuban et al., 2021; Kobayashi et al., 2016). Cultures of primary microglia released proinflammatory mediators, including IL-1β, IL-6, TNF-α, and G-CSF, at 24 and 96 h after exposure to acrylamide (Zhao et al., 2017). Furthermore, rats exposed to acrylamide showed upregulation of NF-ĸB, IFN-γ, IL-1β, and TNF-α mRNAs in the liver and brain (Acaroz et al., 2018).

Based on the above background, the present study was designed to determine the role of IL-1β in acrylamide-induced neurotoxicity.

Materials and Methods

Chemicals and preparation

Acrylamide (lot no. A9099, purity >99%) was purchased from Sigma-Aldrich (St Louis, Missouri). It was freshly prepared at the beginning of each week by dissolving in drinking water filtered through a G-10 ion exchange cartridge (Organo, Tokyo, Japan), and then stored at 4°C and administered by oral gavage every day of the week using autoclaved tubes.

Animal husbandry and experimental design

Ten-week-old male mice were used in the present study. Thirty male-specific pathogen-free C57BL/6msSlc mice were purchased from SLC Japan (Tokyo) at 9 weeks of age and allowed to acclimatize for 1 week before the start of the study. The IL-1β KO mice were backcrossed C57BL/6msSlc with congenicity of >99.998 at the Institute of Medical Science, the University of Tokyo. At 6–8 weeks of age, the DNA was extracted from ear samples of each mouse and analyzed by polymerase chain reaction (PCR) using primers (Lac Z GAGGTGCTGTTTCTGGTCTTCACC, IL-1β common CACATATCCAGCACTCTGCTTTCAG, IL-1β WT GGTCAGTGTGTGGGTTGCCTT), in order to confirm the genotype. The PCR was conducted by a 3-step cycle under conditions of 96°C for 2 min followed by 35 cycles of 96°C for 20 s, 59°C for 30 s, and 72°C for 45 s. The amplified DNA samples were then run on 2% agarose gel electrophoresis and visualized with a CCD camera (Fusion Solo S; Vilber Lourmat, Collegien, France). IL-1β KO^−/− mice showed 1 band, thus confirming that all the mice were homozygous recessive. The control group consisted of 30 specific pathogen-free age-matched male C57BL/6msSlc wild-type mice purchased from SLC Japan and acclimatized to the new environment over 1 week before the start of the study. All mice were initially housed in separate cages of 4, 6 each, respectively, and had access to filtered drinking water and normal chow diet (Charles River Formular-1; 5LR1) ad libitum. They were housed in a controlled environment of temperature (23°C–25°C), humidity (57%–60%) and light (lights on at 0800 h and off at 2000 h). After the first week of acclimatization, each mouse was weighed and then assigned at random to 1 of 6 groups, each consisting of 10 mice, then exposed to acrylamide (0, 12.5 or 25 mg/kg body weight [bw]). Groups 1–3 (wild-type mice) and groups 4–6 (IL-1 β KO mice) were exposed to acrylamide. Acrylamide was dissolved in filtered drinking water as mentioned earlier, and administered by oral gavage. Mice of each group (n = 4 and 6, respectively) were housed in 4 and 6 per cage for morphological and biochemical analysis, respectively, and exposed to acrylamide by oral gavage every day of the week for 28 days. In the present study, 25 mg/kg bw was used as the highest exposure level for acrylamide based on the findings of previous studies in rats using 20 mg/kg bw (Zong et al., 2019).

The protocol and experimental design of the present study were approved by the animal experimentation committee of Tokyo University of Science (Experiment approval number Y-21016) and strictly followed the guidelines of Tokyo University of Science on animal experiments, in accordance with the Japanese act on welfare and management of animals.

Landing foot spread test

The landing foot spread test was carried out in accordance with the United States Environmental Protection Agency’s (USEPA) recommended protocol for functional observatory battery testing for the effects of drugs and other chemicals on the nervous system, as described in detail previously (Edwards and Parker, 1977; Ekuban et al., 2021; Gilbert and Maurissen, 1982). Briefly, after applying a dye ink to the soles of the hindlimbs, mice were dropped from a height of 15 cm. The hindlimb splay length represented the distance spread between the left and right soles upon landing. The test was repeated 3 times and the mean landing foot splay distance was calculated and used as the representative value for the individual mouse for statistical analysis.

Euthanasia, tissue harvest, processing, and morphological assessment

At 24 h after the last exposure to acrylamide, mice were euthanized for morphological examination. For the latter, mice (n = 4/group) were deeply anesthetized by intraperitoneal injection of sodium pentobarbitone (50 mg/kg). Upon confirmation of loss of skin sensation, the animals were transcardially perfused through the ascending aorta with 4% paraformaldehyde in phosphate buffer (4% PFA). The perfused mice were wrapped in aluminum foil and kept on ice for a period of 1 h to increase the penetrative effect of paraformaldehyde particularly through the brain tissues. The brain was dissected out of the skull carefully and fixed for additional 24 h at 4°C. After this, the brain was divided into 3 parts by cutting coronally at the anterior margin of the cerebellum and the optic-chiasm and then placed in a series of 10%, 20%, and 30% sucrose solutions over changing intervals of 24 h each. Brain tissues (cortex area) were then embedded in optimum cutting temperature (OCT) medium with the use of plastic Tissue Tek cryomolds (SFJ 4566; Sakura Finetek, Tokyo) and then stored at −80°C.

Cryosection of brain tissues

Brain tissues (cortex) embedded in OCT medium were serially sectioned in the coronal plane on a freezing microtome (Leica CM3050S; Leica Microsystems, Wetzlar, Germany) at 40 μm thickness from bregma –0.34 according to Paxinos and Franklin (2004), which is representative of the full extent of somatosensory cortex in mice. The tissue sections were placed on positively charged slides (MAS Superfrost slides, Matsunami Glass, Osaka, Japan) and allowed to air dry at room temperature for about 1 h, after which they were stored at −80°C for immunostaining.

Immunohistochemical staining

Noradrenergic axon staining

The frozen sections at −80°C were allowed to air dry at room temperature, then rinsed in Tris-buffered saline (TBS; 50 mM Tris, 0.15 mM NaCl, pH 7.5–7.8) followed by transfer into an antigen retrieval solution containing 10 mM sodium citrate buffer (pH 8.5) that had been preheated and kept in a water bath at 80°C for 30 min. Then the sections were cooled to room temperature together with the buffer solution and washed in TBS with 0.01% Tween-20 (TBST) 3 times (each for 5 min). Endogenous peroxidase activity was blocked by incubating the sections for 20 min with peroxidase blocking reagent Bloxal (Vector Laboratories, Burlingame, California). After washing 3 times in TBST, nonspecific protein binding was blocked at 4°C overnight using protein blocking reagent (1% bovine serum albumin [BSA; Sigma-Aldrich], 2.5% normal horse serum [NHS; Vector Laboratories], 0.3 M glycine [FUJIFILM Wako Pure Chemical, Osaka], and 0.1% Tween-20 [FUJIFILM Wako Pure Chemical]). This was followed by incubation at 37°C for 30 min then rinsing 3 times in TBST. Endogenous biotin was blocked by incubating the sections in avidin/biotin blocking reagent (Sp-2001; Vector Laboratories), as described by the manufacturer. The sections were then incubated for 2 h at 37°C with mouse antinoradrenaline transporter antibody (NAT; dilution, 1:1000, no. ab211463; Abcam, Cambridge, UK). After incubation with the primary antibody, the sections were washed 3 times and then incubated for 1 h with horse antimouse biotinylated secondary antibody (BA-2000; Vector Laboratories) and further washed 3 times in TBST. At the final step, the sections were stained with the avidin-biotin peroxidase complex (Elite ABC reagent; Vector Laboratories) and visualized by reacting with diaminobenzidine peroxidase substrate as the chromogen (ImmPACT DAB [Brown] peroxidase substrate SK-4105; Vector Laboratories). The DAB peroxidase reaction was stopped and the sections were rinsed with water, followed by 3 washes with TBS. The sections were wiped off any liquid, allowed to air dry and mounted with an aqueous mounting medium (VectaMount Mounting Medium, H-5501; Vector Laboratories).

Morphometric analysis of noradrenergic axons

Uncompressed photomicrographs of the stained somatosensory cortex regions were taken with a Leica FlexCam C1 digital camera-assisted microscope (BX 50; Olympus, Tokyo), using the whole area with the vessel analysis plugin in the ImageJ software (Schneider et al., 2012). The density of noradrenergic axons was quantified in the primary somatosensory cortex (S1) of forelimb (S1FL), hindlimb (S1HL), and barrel field (S1BF) and secondary somatosensory cortex (S2) subregions of the somatosensory cortex at Bregma –0.34 (Paxinos and Franklin, 2004), using a 300 μm × 300 μm, modified from square sampling frame (Davuljigari et al., 2021) with the vessel analysis plugin in the ImageJ software (Schneider et al., 2012). We also determined the vascular density, which represented the ratio of the vessel area relative to the total area multiplied by 100%. These studies were conducted in 4 mice and 2 sections from each were used for analysis. Blind analysis of immunohistochemistry sections of the 4 areas of the somatosensory cortex (S1BF, S1HL, S1FL, and S2) was conducted by a second scorer for result validation.

Isolation of total mRNA, synthesis of cDNA, and real-time quantitative polymerase chain reaction

Total messenger RNA (mRNA) was isolated from the cerebral cortex (n = 6/each group) using the ReliaPrep RNA Tissue Miniprep System (Promega, Madison, Wisconsin), according to the instructions provided by the manufacturer. The concentration of the extracted mRNA following elution with RNase-free water was measured using NanoDrop 2000 spec-trophotometer (Thermo Fisher Scientific, Waltham, Massachusetts). The quality of mRNA was determined by confirming that the A260/A280 ratio was ≥2.0 after measuring absorbance at 260 and 280 nm. Complementary DNA (cDNA) was then synthesized by using 4 μg of the extracted total RNA with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, California) according to the instructions supplied by the manufacturer. Real-time quantitative PCR was performed by using the THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka) and the AriaMx Real-Time PCR System (Agilent Technologies, Santa Clara, California). The PCR reaction component (20 µl final volume): cDNA 2 µl, forward primer (10 µM) 0.4 µl, reverse primer (10 µM) 0.4 µl, SYBR qPCR mix 10 µl, 50× ROX reference 0.04 µl and nuclease-free water 7.16 µl. A 3-step real-time PCR amplification reaction comprising an initial denaturation step at 95°C for 1 min, followed by an amplification step of 40 denaturation cycles at 95°C for 15 s, primer annealing at 60°C for 30 s, extension at 72°C for 60 s and reading of plate was utilized. A melting curve step from 55°C to 95°C with 0.5°C increments for 5 s followed by a plate read was also incorporated. A standard curve constructed using serial concentrations of diluted cDNA samples from the control group was used to quantify the relative expression level of each gene. The latter was calculated by standardization to the endogenous mRNA levels of the housekeeping gene β-actin. The mRNA expression levels of Nrf2 and antioxidant genes: heme oxygenase 1 (Ho-1), NAD(P) H: quinone oxidoreductase 1 (Nqo1), superoxide dismutase-1 (Sod-1), glutathione-s-transferase mu (Gst-m), glutathione-s-transferase mu-5 (Gst-m5), thioredoxin reductase 1 (Txnrd1), thioredoxin reductase L (TxnL) and metallothionein 1 (Mt-1), glutathione peroxidase 1 (Gpx1), glutathione peroxidase 4 (Gpx4), glutamate-cysteine ligase, catalytic subunit (Gclc), and glutamate-cysteine ligase, modifier subunit (Gclm), as well as genes of several proinflammatory cytokines, including interleukin-6 (Il-6), interleukin-18 (Il-18), nuclear factor kB (Nfkb1), caspase-1 (Casp1), tumor necrosis factor alpha (Tnf-α), inducible nitric oxide synthase (Nos2), and cyclooxygenase 2 (Cox-2) were analyzed. Primer sequences for the various genes are listed in Supplementary Table 2.

Preparation of cytoplasmic and nuclear extracts for Western blotting and Nrf2 activation assay

Cytoplasmic and nuclear extracts were prepared from the cerebral cortex tissues using NE-PER Nuclear and Cytoplasmic Extraction Reagent 78833 (Thermo Fisher Scientific Inc., Rockford, Illinois). The cytoplasmic and nuclear extracts were used for Western blotting and Nrf2 activation assay, respectively.

Western blotting

The protein concentration in the cytoplasm was determined using Pierce 660 nm Protein Assay Reagent (Pierce Biotechnology, Waltham, Massachusetts). The concentration-adjusted protein solutions were mixed with the sample buffer (final concentration; 62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.0075% bromophenol blue, 5% β-mercaptoethanol) and boiled at 95°C for 5 min. Each 10 μg protein sample was separated on Mini-PROTEAN TGX Gels 4%–20% (Bio-Rad Laboratories Inc., Hercules, California) and transferred onto PVDF membranes. Protein-blocking was applied using BlockPRO Blocking Buffer (BF01-1L, Visual Protein, Taipei, Taiwan) for 30–60 min. The membranes were incubated overnight at 4°C with the primary antibody dissolved in 1% BSA/TBS-T: anti-β-actin rabbit mAb (4970S, dilution 1:5000; Cell Signaling Technology, Danvers, Massachusetts), anti-NQO1 rabbit mAb (11451-1-AP, dilution 1:5000; Proteintech Group, Inc, Rosemont, Illinois), anti-GSTM1 rabbit mAb (12412-1-AP, dilution 1:5000; Proteintech), anti-HO-1 rabbit mAb (ab13243, dilution 1:4000; Abcam), or IL-6 (D5W4V) XP rabbit mAb (no. 12912, dilution 1:2000, Cell Signaling Technology) and then incubated with the secondary antibody; goat anti-rabbit IgG-peroxidase Ab (A0545, dilution 1:40000; Sigma-Aldrich) dissolved in 1% BSA/TBS-T at room temperature for 1 h. Protein bands were emitted with ImmunoStar Zeta (FUJIFILM Wako Pure Chemical) for NQO1, GSTM1, HO-1, IL-6, and β-actin, followed by visualization in Fusion Solo S (Vilber Lourmat, Collégien, France).

Assay for Nrf2 activation using ELISA with oligonucleotide containing ARE (antioxidant response element) consensus binding site

TransAMNrf2 (Active Motif, Carlsbad, California) was used to quantify Nrf2 activation using the method supplied by the manufacturer. Active Nrf2 was captured by the kit component 96-well plate with an immobilized oligonucleotide containing ARE consensus binding site (5’-GTCACAGTGACTCAGCAGAATCTG-3′). Anti-Nrf2 antibody followed by HRP-conjugated antibody and color developing was applied to the nuclear extracts, and absorbance at 450 and 655 nm was measured as the extent of Nrf2 activation. The final absorbance was calculated by subtraction of the value at 450 nm from the value at 655 nm. Twenty-five micrograms nuclear protein per well was applied in this ELISA-based assay.

Assessment of oxidative stress

Glutathione assay (quantification of total and oxidized glutathione)

Because the quantity of the cortical samples available for glutathione assay was inadequate, the cerebellum was used in this part of the study as a surrogate for the cerebral cortex. Cerebellar levels of total glutathione and oxidized glutathione were measured using glutathione assay kit no. 703002 (Cayman Chemical Company, Ann Arbor, Michigan). Frozen cerebellum was broken into powder on aluminum foil placed on a stainless steel block precooled by liquid nitrogen, and well mixed. Approximately 25 mg of frozen powdered cerebellar tissue sample was homogenized in 250 μl of 50 mM 2-(N-morpholino), ethanesulphonic acid (MES) buffer containing 2 mM ethylenediaminetetraacetic acid (EDTA). The homogenate was centrifuged at 10 000× g for 15 min at 4°C. The supernatant was then deproteinated with an equal volume of 0.1% metaphosphoric acid (#239275; Sigma-Aldrich) and mixed by vortex. The resultant mixture was allowed to stand at room temperature for 5 min and centrifuged at 2000× g for 2 min. The supernatant was aliquoted and stored at –20°C until analysis of total and oxidized glutathione. In the next step, 40 μl of the supernatant was treated with 2 μl of 4 M solution of triethanolamine (TEAM; Sigma-Aldrich) and vortexed immediately. For determination of total reduced glutathione (GSH), 20 μl TEAM-treated sample was diluted 10-fold using the MES buffer. Subsequently, 50 μl of the diluted sample was added to 150 μl freshly prepared assay cocktail (mixture of cofactors, enzymes, and DNTB reconstituted in MES buffer) and incubated for 25 min. Absorbance of the mixture at 405 nm was measured with a microplate reader (Gen5TM Secure, BioTek Instruments, Inc. Charlotte, Vermont).

To determine the level of oxidized glutathione (GSSG), 20 μl of the TEAM-treated sample was diluted 5-fold with MES buffer and 100 μl of the diluted solution was derivatized with 1 μl of 2-vinylpyridine (Sigma-Aldrich). The mixture was vortexed and incubated for 1 h at room temperature. Next, 50 μl of the derivatized sample was mixed with 150 μl of freshly prepared assay cocktail as explained earlier, incubated for 25 min in the dark and then the absorbance of mixture was measured at 405 nm using a microplate reader. The concentrations of GSH and GSSG were calculated using a standard plot with GSSG standard provided with the kit and expressed in µM/mg protein of GHS or GSSG.

Malondialdehyde assay

The cerebellum was also used as a surrogate for cerebral cortex in malondialdehyde (MDA) assay. Cerebellar MDA level was measured using NWLSS, malondialdehyde kit (NWK-MDA01, Northwest Life Science Specialties, LLC, Vancouver, Washington) and the instruction provided by the manufacturer. Briefly, 25 mg of frozen powdered cerebellar tissue sample was homogenized in cold assay buffer, centrifuged at 5000 × g for 15 min, then the supernatant was stored on ice. Next, 30 µl of the sample was diluted 5 times with the cold assay buffer, then 150 µl of the diluted sample or the calibrator was mixed with 6 µl of butylated hydroxytoluene (BHT) reagent, 150 µl of acid reagent, and 150 µl of 2-thiobarbituric acid (TBA) reagent. The mixture was vortexed vigorously, then incubated at 60°C for 60 min. One hour later, the mixture was centrifuged at 10 000 × g for 2–3 min, then transferred to a microplate and absorbance was measured at 532 with a microplate reader (Gen5TM Secure, BioTek Instruments, Inc. Charlotte, Vermont). Finally, MDA concentration was calculated using the MDA colorimetric standard curve and expressed in µM/mg protein of MDA.

Statistical analysis

Data were expressed as mean ± standard deviation (SD). Differences among groups in each genotype of wild-type and IL-1β KO mice were analyzed by 1-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison test. When ANOVA showed difference between groups, simple regression analysis with independent variable of acrylamide level was carried out for data of each genotype to test the trend with acrylamide exposure level. Multiple regression analysis with independent variables of acrylamide level and genotype, which was defined by dummy variables (0: wild-type, 1: IL-1β KO), in the full model with interaction, was carried out to test the interaction between acrylamide level and genotype. A probability (p) of <.05 denoted the presence of a statistically significant difference. Student’s t-test was conducted for comparison between wild-type mice and IL-1β KO mice exposed to the same concentrations of acrylamide. All statistical analyses were performed using GraphPad Prism version 9.0 (GraphPad Software, La Jolla, California) or JMP (version 14, SAS Institute, Cary, North Carolina).

Results

Effect of acrylamide on body weight and brain weight

Exposure to acrylamide at 12.5 and 25 mg/kg bw did not change body or brain weight in both the wild-type and IL-1β KO mice (ANOVA; Table 1).

Functional changes (landing foot spread test)

The results showed acrylamide dose-dependent increase in foot spread (hind limb splay) with a significant change at 25 mg/kg bw in IL-1β KO mice (ANOVA followed by Dunnett’s multiple comparison test; Figure 1 and Table 2). However, no such effect was noted in the wild-type. Multiple regression analysis showed significant interaction between acrylamide concentration and IL-1β deletion, suggesting different intensity of acrylamide-induced increase in hindlimb splay length by genotype (Table 2). Student’s t-test showed that hindlimb splay distance was significantly larger in IL-1β KO than wild-type mice exposed to the 25 mg/kg bw dose (Figure 1).

Effect of acrylamide on noradrenergic axons

The density of noradrenergic-immunoreactive axons was quantified in the primary (S1HL, S1BF, S1FL) and secondary (S2) regions of the somatosensory cortex. Exposure to acrylamide dose-dependently decreased the density of noradrenergic axons with significant changes at 25 mg/kg bw in S1BF, S1FL, S1HL, and S2 in IL-1β KO mice (ANOVA followed by Dunnett’s multiple comparison test and simple regression analysis; Figs. 2–5 and Table 2). Multiple regression analysis with dummy variable (0: wild-type, 1: IL-1β KO mice) was conducted to test the interaction of acrylamide concentration and IL-1β deletion. The results showed a significant interaction of acrylamide concentration and IL-1β deletion on the density of noradrenergic axons in the S1BF, S1FL, S1HL, and S2 areas of the somatosensory cortex (Table 2). Further analysis showed significantly lower density of noradrenergic axons in the S1BF, S1HL, and S2 areas in IL-1β KO mice than in wild-type mice exposed to the 25 mg/kg bw dose (Student’s t-test). However, no such changes in the density of these axons were noted in the SIFL area between IL-1β KO—and wild-type mice exposed to the 25 mg/kg bw dose (Student’s t-test).

Effects of acrylamide on mRNA expression

Nrf-2 and antioxidant genes

Exposure to acrylamide at 25 mg/kg bw significantly increased the mRNA expression levels of Nrf-2, heme oxygenase 1 (Ho-1) and NAD(P)H: quinone oxidoreductase 1(Nqo-1) and increased the mRNA expression level of glutathione S-transferase mu (Gstm), with a significant change at 12.5 mg/kg in wild-type mice (ANOVA followed by Dunnett’s multiple comparison test; Figure 6A) but there was no significant interaction between acrylamide concentration and IL-1β deletion for the above genes (multiple regression analysis; Supplementary Table 1). Exposure to acrylamide at 25 mg/kg bw significantly increased the expression levels of Gpx1, Gpx4, and Gclc in wild-type mice, whereas significantly decreased the expression of Gpx1, Gpx4, and Gclc in IL-1β KO mice (ANOVA followed by Dunnett’s multiple comparison test; Figure 7A). Multiple regression analysis showed significant interaction between acrylamide concentration and Nrf2 deletion for Gpx1, Gpx4, and Gclc, suggesting significant effect of IL-1β deletion on the rate of acrylamide-induced change in the above genes (Supplementary Table 1). Acrylamide had no effect on the expression of other investigated antioxidant genes in both the wild-type and IL-1β KO mice (ANOVA; Figs. 6A and 7A).

Proinflammatory cytokines

Exposure to acrylamide dose-dependently increased the mRNA expression of IL-6 with a significant change at 25 mg/kg bw in wild-type mice, but no such effect was noted in IL-1β KO mice (ANOVA followed with Dunnett’s multiple comparison test; Figure 8).

Effects of acrylamide on HO-1, NQO1, and GSTM1 protein levels

The protein levels of IL-6, HO-1, NQO1, and GSTM1 were measured in wild-type and IL-1β KO mice by Western blot technique. Exposure to acrylamide had no significant effect on IL-6, HO-1, NQO1, and GSTM1 protein levels in both genotypes (Supplementary Figure 1).

Effects of acrylamide on extent of Nrf2 activation

The extent of Nrf2 activation was measured by ELISA using oligonucleotide containing the ARE consensus binding site. Exposure to acrylamide dose-dependently decreased the extent of Nrf2 activation with significant changes at 12.5 and 25 mg/kg bw in the wild-type but not in IL-1β KO mice (Figure 6B).

Effects of acrylamide on total and oxidized glutathione levels

Exposure to acrylamide at 25 mg/kg bw significantly increased the levels of total glutathione and oxidized glutathione (GSSG) in wild-type mice but significantly decreased oxidized glutathione and the ratio of GSSG/GSH in IL-1β KO mice (ANOVA followed by Dunnett’s multiple comparison test; Figure 7B).

Effects of acrylamide on malondialdehyde (MDA)

Acrylamide had no effect on MDA levels in both mouse genotypes (ANOVA). However, comparison of baseline data (ie, at 0 mg acrylamide/kg bw) showed a significant difference in MDA level between wild-type and IL-1β KO mice (p = .0358, by Student’s t-test) (Figure 7B).

Discussion

In the present study, we used IL-1β knockout mice to test the hypothesis that deletion of IL-1β protects the mouse brain against acrylamide-induced neurotoxicity. This concept arose from our previous work that showed an increase in mRNA and protein expression levels of IL-1β in rats exposed to acrylamide at 20 mg/kg bw, as well as in BV2 murine microglia cell line (Zong et al., 2019). Surprisingly, the findings of this study suggest that deletion of IL-1β exacerbates the neurotoxicity of acrylamide in mice. The results of the landing foot spread test and the morphometric study demonstrated the protective role of IL-1β against acrylamide-induced sensorimotor dysfunction and degeneration of noradrenergic axons.

Previous in vivo studies reported the neuroprotective role of IL-1β in mechanically injured brain or experimental compound-induced neurodegeneration in rodents. Experimental evidence suggests that IL-1β promotes the survival of cortical neurons around the stab wound brain injury in mice (Abd-El-Basset et al., 2020). Furthermore, remyelination failed to occur in IL-1β KO mice treated with cuprizone, which induces demyelination (Mason et al., 2001). However, to the best of our knowledge, the present study is the first to demonstrate the protective role of IL-1β in environmental chemical-induced encephalopathy.

The toxic effect was especially pronounced in the 25 mg/kg bw IL-1β KO group, compared with the wild-type group. Splaying of the hind limbs (Figure 1) is a sign of neurotoxicity and also a sign of motor dysfunction (Mangiarini et al., 1996; Takahashi et al., 2009). Previous studies reported that the landing foot spread test is a sensitive marker of early acrylamide-induced neurotoxicity (Edwards and Parker, 1977; Gilbert and Maurissen, 1982). Furthermore, our recent work demonstrated a clear positive association between increase in landing foot splay and monoaminergic axon degeneration in Nrf2 KO mice (Ekuban et al., 2021).

Exposure to acrylamide also dose-dependently decreased the density of noradrenergic axon in the area of mouse somatosensory cerebral cortex. This area consists of primary somatosensory cortex (S1) of the forelimb (S1FL), hind limb (S1HL), and barrel filed (S1BF) and secondary somatosensory cortex (S2) (Davuljigari et al., 2021). The above changes were noted in IL-1β-KO mice but were attenuated in the wild-type (Figs. 2–5), suggesting the protective role of IL-1β against acrylamide-induced neurodegeneration. The somatosensory cortex is responsible for processing sensory information from various parts of the body, including the face, fingers, legs, toes, and hands. The entire body is completely represented in both the SI and SII (Disbrow et al., 2000; Kaas et al., 1979; Ruben et al., 2001), highlighting the importance of the brain somatosensory cortex area. Admittedly, it is not clear at this stage whether the more profound effect of acrylamide on LFS in the IL-1β KO mouse (relative to the wild-type) is due to noradrenergic axon degeneration in the somatosensory cortex area, effect of IL-1β deletion on peripheral nerves, or the synergistic effect of both of these pathologies, because previous studies reported that IL-1β plays a role in sciatic nerve regeneration (Rotshenker et al., 1992; Wu et al.,, 2018). Further studies are needed to determine the exact link between deletion of IL-1β and acrylamide-induced toxic effect on the peripheral nerves.

The results of acrylamide-induced increase in total glutathione and Gclc expression in wild-type mice compared with downregulation of Gclc in IL-1β KO mice suggest that the neuroprotective effect of IL-1β is mediated through glutathione synthesis. In this regard, it was reported previously that IL-1β can provide protection for neurons against oxidant-induced injury through enhancement of glutathione production in astrocytes (Chowdhury et al., 2018). Our findings of acrylamide-induced increase in GSSG as well as enhanced Gpx1 and Gpx4 expression in wild-type mice compared with decrease in GSSG and downregulation of Gpx1 and Gpx4 in IL-1β KO mice suggest that the neuroprotective effect of IL-1β is mediated through the enhancement of GSSG production. Our finding of acrylamide-induced upregulation of Gpx1 and Gpx4 in wild-type mice is in agreement with a previous study that reported increase in GPX activity in the rat brain after exposure to acrylamide by drinking water at 50 mg/300 ml for 24 h on alternate days for 13 days (Dasari et al., 2018). Another in vitro study showed no accumulation of GSSG, slower clearance of H₂O₂, and increased susceptibility to peroxide-induced cell death in GPX1^−/− mouse astrocytes treated with H₂O₂ (Liddell et al., 2006), suggesting the contribution of GPX1 to the production of GSSG and clearance of H₂O₂ in astrocytes, resulting in astrocyte survival.

Another important finding of our study was that acrylamide induced upregulation of Nrf2 and antioxidants (Ho-1, Nqo-1, and Gst-m) in wild-type mice, compared with the lack of these effects in IL-1β KO mice (Figure 6). However, the extent of Nrf2 activation decreased dose-dependently in wild-type mice although acrylamide had no effect on HO-1, NQO-1, and GST-M protein levels in wild-type and IL-1β KO mice. These results make it difficult to define the role of Nrf2 pathway and related antioxidants in the observed increased susceptibility of IL-1β KO mice to acrylamide-induced neurotoxicity.

The present study has certain implications for occupational and environmental health and/or clinical medicine. First, the study revealed a protective role of IL-1β in acrylamide-induced encephalopathy, thus indicating that acrylamide-induced increase in IL-1β does not necessarily lead to neurotoxic effects. This is useful for interpreting the rise in IL-1β in extrapolation from experimental animals to humans in risk assessment of acrylamide. Second, the study implies that IL-1β inhibitors can be used carefully in treatment of patients suspected with environmental chemicals-induced encephalopathy.

The present study has also certain limitations. First, we used the cerebellum for glutathione and MDA assay as a surrogate for the cerebral cortex because of the limited amounts of samples. Although changes in the levels of glutathione and oxidized glutathione follow similar trends in the cerebrum and cerebellum after acute or subchronic exposure to the electrophile 1-bromopropane (Wang et al., 2002,, 2003), we need to confirm that regulation of glutathione metabolism is similar in the cerebral cortex and cerebellum. Second, we did not investigate the exact mechanism of acrylamide-induced upregulation of Gclc, Gpx1, or Gpx4 and the role of IL-1β in this process. Third, we limited our investigation of the neuroprotective effect of IL-1β to the roles of glutathione synthesis and glutathione peroxidation; the roles of other mechanisms cannot be ruled out. Further studies are needed to clarify the above problems.

In conclusion, we have demonstrated in the present study the protective role of IL-1β against acrylamide-induced sensorimotor dysfunction and degeneration of noradrenergic axons in the somatosensory cortex of mice. This action is probably mediated through the suppression of oxidative stress by glutathione synthesis and peroxidation.

Supplementary data

Supplementary data are available at Toxicological Sciences online.

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Acknowledgments

We thank Ms Satoko Arai for the excellent secretarial support throughout the study.

Funding

This work was supported in part by grants #17H06396 and #19H04279 from the Japan Society for the Promotion of Science.

References