Abstract
We aimed to investigate the pharmacological effects and mechanisms of the Aitongping formula for treating cancer pain.
We enrolled 60 cancer patients with Numeric Rating Scale above 4 and grouped them randomly as a Control group (N = 30) and a Patch group (N = 30). We also established bone cancer mice models via tumor implantation. And the animal groups were established as a Sham group, a tumor cell implantation (TCI) group, a TCI + Patch group, and a Patch group.
After the validation of successful tumor implantation, we identified candidate miRNAs and genes that were dysregulated in TCI mice and compared their expressions between different mice groups. We also observed the effect of Aitongping patch in vitro in mice primary microglia. The time to disease progression and cancer stability were prolonged by Aitongping patch in cancer patients. And the daily morphine dose was lower, and patients’ quality of life was improved in the Patch group. Moreover, Aitongping patch alleviated cancer pain and inhibited microglia activation after the successful implantation of bone tumor in TCI mice. We also observed the dysregulation of miR-150-5p and chemokine CXC motif ligand 12 (CXCL12) mRNA in TCI mice. And CXCL12 was found to be targeted by miR-150-5p. Aitongping patch was found to upregulate miR-150-5p and downregulate CXCL12 in vivo and in vitro.
Aitongping patch could alleviate cancer pain via suppressing microglia activation, and the downregulation of miR-150-5p, as well as the upregulation of CXCL12 mRNA and protein, induced by tumor implantation or lipopolysaccharide stimulation, was restored by Aitongping treatment.
What is already known on this topic?
As cancer pain significantly impacts the prognosis and quality of patient’s life following anticancer treatment, it is crucial to explore ways to alleviate cancer pain with improved safety and higher efficacy. Pharmacology and clinical studies have shown that the Aitongping formula has a definite analgesic effect and causes almost no side effects.
What this study adds?
Our study finds that Aitongping patch could upregulate miR-150-5p and downregulate CXCL12 in vivo and in vitro. Aitongping patch could alleviate cancer pain via suppressing microglia activation, and the downregulation of miR-150-5p, as well as the up-regulation of CXCL12 mRNA and protein, induced by tumor implantation or LPS stimulation, was restored by Aitongping treatment.
How this study might affect research, practice, or policy?
The findings of our study advance understanding of pain mechanisms and microglia modulation. Medical practice could be influenced with a potential new pain management option, improving patient care and quality of life. This may impact policies on pain management and encourage interdisciplinary collaborations. Our study’s insights also guide future therapeutic development and broaden scientific knowledge on microglia and miRNA roles beyond cancer pain.
Introduction
Pain is a prevalent symptom among cancer patients, with varying incidence rates depending on the stage of the tumor and type of cancer treatment. Research shows that 39% of patients experience cancer-related pain after anticancer treatment, 55% during anticancer treatment, and 66% during the end-of-life phase or metastatic disease [1]. Regardless of the stage of the tumor, 51% of cancer patients will experience pain, while 40% of cancer patients will suffer from moderate to severe pain [2]. Patients with head and neck cancer report the highest incidence of pain, followed by patients with gynecological malignant tumors, digestive system cancers, lung cancer, breast cancer, and genitourinary system cancers [3]. The Numeric Pain Rating Scale (NRS) is a structured numerical representation of the Visual Analog Scale, on which individuals choose a whole number between 0 and 10 to indicate the level of pain intensity they are experiencing, indicating no pain to the most severe pain [4, 5].
Microglia are resident macrophages that make up 5%–10% of all glial cells in the central nervous system [6]. They play an essential role in maintaining tissue homeostasis by clearing dead cells, microorganisms, abnormal proteins, excess synapses, soluble antigens, and other molecules that may threaten tissue homeostasis [7]. Meanwhile, microglia can contribute to the pain regulation, the neuronal networks maintenance, and injury repair [8]. During the presence of cancer pain, microglia can alter in morphology, microglialization, inflammatory genes upregulation, and transcriptional activation [9].
As a type of RNA that participates in the various complex cellular processes by regulating gene expressions, several microRNAs (miRNAs), including miR-150-5p [10], have been reported to modulate microglia activation and thus participate in the pathogenesis of pain. It was found that the overexpression of miR-150 significantly alleviated neuropathic pain development and reduced the expressions of COX-2, IL-6, and TNF-α in rats suffering from chronic sciatic nerve injury [10]. Furthermore, the dysregulation of certain miRNAs can lead to chronic neural inflammation, excessive microglia activation, abnormal macrophage polarization, and disruption of cell communication, which can affect pain occurrence and development [11, 12].
Chemokine CXC motif ligand 12 (CXCL12), also known as stromal cell-derived factor 1, is found in cells in the central nervous system. CXCL12 plays a crucial role in neural development, neural genesis, neuron migration, and differentiation [13]. The main receptor for CXCL12 is chemokine CXC motif receptor 4 (CXCR4), a G protein-coupled receptor produced by stromal cells, fibroblasts, and epithelial cells in various tissues [14]. Increasing evidence indicates that the interactions between tumor stromal cells may regulate tumor initiation and progression [15]. CXCL12, as well as CXCR4, are identified as key factors in the development and metastasis of tumors. CXCL12 is highly expressed in ovarian epithelial tumor cells, and CXCL12 can stimulate ovarian cancer cell growth in vitro by activating the signaling of AKT and ERK [16]. Besides, the dysregulated expression of CXCL12 is also associated with the prognosis and clinical outcomes in breast cancer, bladder cancer, gastric cancer, liver cancer, prostate cancer, lung cancer, and many other human tumors [17].
As cancer pain significantly impacts the prognosis and quality of patient’s life following anticancer treatment, it is crucial to explore ways to alleviate cancer pain with improved safety and higher efficacy. Pharmacology and clinical studies have shown that the Aitongping formula has a definite analgesic effect and causes almost no side effects [18, 19]. In this study, we aimed to investigate the pharmacological effects and mechanisms of the Aitongping formula for treating cancer pain, and we therefore compared the effect of Aitongping patch treatment in human, animal, and cellular models.
Materials and methods
Patient enrollment
This study enrolled 60 patients diagnosed as carrying malignant tumors in Rudong Traditional Chinese Medicine Hospital from January 2019 to June 2020. The institutional human research ethics committee has approved this research and all methods were performed in accordance with the Declaration of Helsinki. Written informed consent was obtained from all patients or their first-degree relatives before the study. Adult patients under 70 years old with NRS score between 4 and 6 (moderate pain) were selected for this study. Other inclusion criteria include: a predicted survival time of >6 month, no history of drug allergies, and intelligence at normal level. The exclusion criteria include: disability for oral intake, brain metastasis, significant dysfunction in heart, liver, or kidney, bleeding or bleeding tendencies, history of drug abuse, mental or consciousness disorders, undergoing radiation or chemotherapy, and pregnant or lactating. Demographic data such as age and sex, and clinical characters such as primary tumor site and cancer pain site of all participants were collected and compared.
Patient groups and data collection
The enrolled patients were randomly grouped into a Patch group (N = 30) and a Control group of which the patients were orally give the two-step Western medicine pain relief treatment (N = 30). For the Patch group, the patients were given one Aitongping Patch every 7 days. If the pain is controlled with an NRS score of <3, the patch will be applied for another 8 weeks. If the pain cannot be relived, the patients will be treated with opioid drugs while taking patches for another 8 weeks, and the patient data will be excluded from the study. For the Control group, the patients will be given oral treatment of codeine (30 mg by every 8 h), tramadol (100 mg by every 12 h), or oxycodone (425 mg by every 8 h) according to the clinical side effects of each participant. If the pain cannot be relived within 24 h, the patient data will be excluded from the study.
To observe the tumor progression status and pain-reliving effects in all patient groups, parameters such as time to disease progression (TTP), the tumor response to treatment, daily morphine usage, and changes in the quality of life of cancer patients were all recorded, evaluated, and analyzed. TTP was defined as the time period between the enrollment and pain aggression. Specially, the tumor response to treatment was evaluated via Response Evaluation Criteria in Solid Tumors, and the quality of cancer patients’ life was evaluated by European Organization for the Research and Treatment of Cancer Quality of Life Questionnaire (EORTC QLQ-C30).
Experimental animal model establishment
We used adult male C3H/HeN mice (Shanghai SLAC Laboratory Animal Co., Ltd, Beijing) weighing between 25 and 30 g in our study. The mice were housed with 12-h light/dark cycles and had free access to food and water. We used the animals to establish four mice groups: a Sham group, a tumor cell implantation (TCI) group, a TCI + Patch group, and a Patch group. For the TCI process, 2472 NCTC mouse tumor cells (ATCC, MA, USA) were cultured in NCTC-135 medium (Sigma-Aldrich, MO) containing 10% fetal bovine serum (FBS, HyClone, USA). After anesthetization by i.p. injection of 50 mg/kg pentobarbital, the mice were shaved and disinfected. An incision above the left tibial tuberosity was made to expose the distal end of the femur. And 20 μl of cell culture medium containing 1 × 105 2472 NCTC mouse tumor cells were injected into the medullary cavity. For the Sham group and Patch group, the mice were injected with 20 μl of cell culture medium without 2472 NCTC mouse tumor cells contained. For the TCI + Patch treatment, the TCI mice were applied with patches containing Aitongping herb paste to the back. Each patch was cut into 0.15 cm2 and was replaced with new patches every 7 days for 21 days. And the animals in the Patch group were applied with blank control patch, which contains no medical ingredients. Subsequently, paw withdrawal threshold (PWT) and paw withdrawal latency (PWL) were evaluated to evaluate the pain behaviors of each animal group. Moreover, the L4–L5 spinal segments were removed for further analysis. All animals were sacrificed by the end of this study. This study was approved by the institutional animal ethics committee, and all experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals by the National Institutes of Health and the Guide for Pain Research by the International Association for the Study of Pain.
Cell experiment design
Primary mouse microglia were purchased from Science Cell (USA) and cultured in astrocyte culture medium containing 5% fetal bovine serum (Science Cell Research, USA). The cell experimental groups were established as a Control group, a lipopolysaccharide (LPS) group, a LPS + Drug group, and a Drug group. For LPS stimulation, the cells were treated with 1 μg/ml of LPS for 0–24 h. For the Drug treatment, Aitongping-treated serum were prepared using C57BL/6 male mice given 32 g/kg Aitongping by gavage twice a day for 7 consecutive days. Two hours after the last administration on Day 8, blood was collected from the abdominal aorta and centrifuged to obtain serum. And the serum containing Aitongping (Aitongping-treated serum) was used to treat primary mouse microglia for subsequent experiments.
Immunofluorescence
Mice were deeply anesthetized with subcutaneous administration of ketamine and xylazine mixture. The abdominal cavity was opened to expose heart. A 23-G needle attached to a peristaltic pump was inserted into the left ventricle of the heart, and PBS was perfused followed by ice-cold 4% paraformaldehyde and 0.12% picric acid. The L4–L5 spinal segments were taken and stored at −80°C for subsequent analysis.
About 240 μm-long L4–L5 spinal cord segments were sliced into 30 μm thick sections and were removed of debris. The sections were then blocked with 5% donkey serum in T-PBS at room temperature for 1 h and incubated with 1:500 diluted anti-Iba1 (catalog number: A19776, ABclonal, China) or anti-CXCL12 antibody (catalog number: AB1325, ABclonal, China) overnight at 4°C. The sections were then washed and incubated with 1:1000 diluted goat polyclonal antibody (catalog number: ab107159, Abcam, UK) overnight at 4°C. Subsequently, the sections were washed and incubated with 1:300 diluted donkey anti-rabbit Alexa Flour 594 (catalog number: Z25007, Thermo Fisher, MA) for 2 h at room temperature. Finally, the sections were washed in PBS, counterstained with DAPI, and mounted with fluorescence mounting medium to observe the staining of Iba-1 or CXCL12.
Fluorescence in situ hybridization
The L4–L5 spinal segments were collected, fixed in DEPC water for 12 h, dehydrated with graded ethanol, embedded in paraffin, and finally sliced with a microtome. The slices were then baked in a 62°C oven for 2 h. After tissue fixation, the slices were boiled and cooled before the application of gene pen stokes. Subsequently, 20 μg/ml proteinase K is digested at 37°C for 10 min. After being prehybridized at 37°C for 1 h and hybridized overnight at 4°C, the slices were blocked with BSA blocking serum at room temperature for 30 min. Mouse anti-digoxin labeled with FITC was added for incubation at 37°C for 50 min. Finally, the slices were treated with DAPI staining solution in the dark for 8 min, washed, and mounted with antifluorescence quenching sealing agent. The prepared slices were observed using a Nikon upright fluorescence microscope.
Western blotting
The L4–L5 spinal segment was removed from anesthetized mice and homogenized in a cold mixture of protein lysis buffer, phosphatase inhibitors, and benzenesulfonyl fluoride. The homogenate was then centrifuged at 12 000 rpm for 30 min at 4°C. After determining the protein concentration using the BCA protein assay kit (Thermo Scientific, MA), the protein samples were loaded onto a 10% SDS-PAGE at a concentration of 50 μg/lane and were then transferred onto a PVDF membrane. The membrane was blocked with 5% bovine serum albumin in 0.1% TBST for 2 h at room temperature, then incubated overnight at 4°C with 1:1000 diluted primary antibodies against Iba1 (catalog number: A19776, ABclonal, China), CXCL12 (catalog number: A1325, ABclonal, China), and β-actin (catalog number: AC026, ABclonal, China). After washing with TBST, we incubated the membrane for 2 h at room temperature with a 1:5000 diluted secondary goat anti-mouse antibody HRP-conjugated (catalog number: AS003, ABclonal, China). Finally, protein bands were detected using the SuperLumia ECL Plus HRP Detection Kit (K22030, Abbkine, China) and exposed using the Bio-Rad ChemiDoc XRS+ Chemiluminescence Imaging System (Bio-Rad, CA). The band intensity was analyzed using the Image Lab software (Bio-Rad Laboratories, CA) and normalized to β-actin.
Quantitative real-time polymerase chain reaction
qRT-PCR analysis was used to analyze the expression of miR-29c (Forward primer sequence: TGACCGATTTCTCCTGG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-152 (Forward primer sequence: TCAGTGCATGACAGAACT; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-101 (Forward primer sequence: CAGTTATCACAGTGCTGA; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-124-3p (Forward primer sequence: TTCACAGCGGACCTTGA; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-340-5p (Forward primer sequence: TATAAAGCAATGAGACTGAT; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-15a (Forward primer sequence: GCAGCACATAATGGTTTG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-200b (Forward primer sequence: CTTACTGGGCAGCATTG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-429 (Forward primer sequence: TACTGTCTGGTAAAACCG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-34c (Forward primer sequence: GGCAGTGTAGTTAGCTG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-26a-5p (Forward primer sequence: CAAGTAATCCAGGATAGG; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-150-5p (Forward primer sequence: TCTCCCAACCCTTGTAC; Reverse primer sequence: GAACATGTCTGCGTATCTC), miR-136 (Forward primer sequence: CTCCATTTGTTTTGATGATG; Reverse primer sequence: GAACATGTCTGCGTATCTC), shisa family member 4 mRNA (Forward primer sequence: AAGACCATAGCAGGCATCGCCT; Reverse primer sequence: GCCTGTCATTGGAATCTCCTGG), transcriptional adaptor 1 (TADA1) mRNA (Forward primer sequence: AGACTGGATCGAAGATGCCTCG; Reverse primer sequence: GCCACCACAATGATGTCGCTGA), GDP dissociation inhibitor 1 (GDI1) mRNA (Forward primer sequence: CCGAGACTGGAATGTTGACCTG; Reverse primer sequence: CCTTGAAGTCCAGGTAGCGAGT), hypoxia inducible lipid droplet-associated (HILPDA) mRNA (Forward primer sequence: TGATGGAGTCCCTAGAGGGCTT; Reverse primer sequence: GCCAGTATGGAAGGAGGTCTTAT), CXCL12 mRNA (Forward primer sequence: CTCAACACTCCAAACTGTGCCC; Reverse primer sequence: CTCCAGGTACTCCTGAATCCAC), and ATP-binding cassette, subfamily B, member 9 (ABCB9) mRNA in mouse spinal cord (Forward primer sequence: TGTCTCTTCCGCTCACTGGTGT; Reverse primer sequence: CCTTGACTGTGTTCCGCAGGAA). Total RNA was extracted from the collected tissues using TRIzol reagent (TaKaRa, JP) according to the manufacturer’s protocol. Reverse transcription reactions were carried out using the FastQuant RT kit (TIANGEN, China). Primers were designed and synthesized by Shanghai Sangon. RT-qPCR was performed according to the instructions of the PCR kit (TIANGEN, China). U6 and GAPDH were used as internal controls for the quantification of gene relative expressions using the 2−ΔΔCt method.
Dual luciferase assay
To identify a consecutive six or more complementary sequence between miRNA and mRNA as a candidate binding site, in-silicon analysis was performed. We further validated this hypothesis by the observation that miRNA introduction may downregulate the level of target mRNA. Therefore, we break the binding interaction by introducing mutant to replace all candidate nucleotides to interrupt the G-C/U-A bond between miRNA and mRNA, and if the downregulation of mRNA by miRNA were restored, it means those mutant-replaced nucleotides function as the binding sites. Finally, we narrowed down the mutants to identify the core binding sites by reducing mutant number from flanking until the restoration effect disappeared. The process of creating a luciferase reporter vector involved amplifying the 3′UTR of CXCL12 cDNA fragment, which contained a potential binding site for miR-150-5p, through PCR. The amplified fragment was then inserted downstream of the luciferase gene in the pmirGlo Dual-Luciferase vector (catalogue number: E1330; Promega, USA). To test the vector, primary mouse microglia were cultured in a 24-well plate and transfected with the vector containing firefly luciferase and either miR-150-5p mimic or control using Lipofectamine 2000 (Invitrogen, Germany). After 48 h, the firefly luminescence and Renilla luminescence were measured and normalized using a dual-luciferase reporter assay system (Promega, USA) according to the manufacturer’s instructions, and relative luciferase activity was calculated.
Statistical analysis
SPSS 17 software was utilized to conduct statistical analysis. The behavioral responses to mechanical and thermal stimuli were compared between groups to determine changes over time. One-way analysis of variance was used for analysis, followed by Tukey’s test as the post hoc test. The data were presented as means with the standard error of the mean. A P-value below .05 was considered significant in terms of statistical analysis.
Results
Demographic and clinical characters of cancer patients
As shown in Supplementary Table 1, there were 17 males and 13 females in the Patch group, with a mean age of 59.13 ± 7.89 years. And there were 16 males and 14 females in the Control group, with a mean age of 60.11 ± 8.34 year. The pain intensity scores indicated by NRS were similar between the Patch group (4.78 ± 0.69) and the Control group (4.61 ± 0.59) before the treatment. Also, there were no significant differences between the two groups in respect to the patients’ primary tumor site and cancer pain site.
Tumor progression and quality of life of cancer patients
As shown in Supplementary Table 2, the TTP, which indicates the time period since the enrollment of the patients until the replacement of planned analgesic treatments by morphine to relive the worsening cancer pain, was evidently longer in the Patch group (56.11 + 20.94 days) compared with that in the Control group (43.56 + 19.52 days). Also, there were 4 partially relieved cases, 24 stable cases, and 2 progressed cases in the Patch group, while there were 12 stable cases and 18 progressed cases in the Control group. Therefore, the stability rate in the Patch group (80%) was significantly higher than that of the Control group (40%). Besides, for patients who used Aitongping patch along with strong opioid drugs in the Patch group, as well as patients in the Control group, their daily morphine usages were calculated. Accordingly, we found that the daily morphine dose by the Patch group (59.41 ± 39.30 mg) was significantly reduced compared with the daily morphine dose by the Control group (98.23 ± 58.53 mg).
Moreover, patients’ quality of life pre- and posttreatment in different treatment groups were scored by the QLQ-C30. As shown in Supplementary Table 3, the life qualities of patients in both groups were significantly improved after the treatment. Meanwhile, compared with the Control group, the improvements in the Patch group are more significant in many aspects.
Aitongping patch relives cancer pain in bone cancer mice
To verify the successful establishment of bone cancer TCI mice models, we recorded and compared the mice PWT/PWL between the Sham group and the TCI group. On the seventh day after tumor implantation, PWT (Fig. 1A) and PWL (Fig. 1B) were both decreased, and were further decreased on the 14th and 21st day after tumor implantation, verifying the successful establishment of bone cancer mice models. Moreover, the pain behavior test results in all animal models demonstrated gradual decreases of PWT (Fig. 1C) and PWL (Fig. 1D) on the 7th, 14th, and 21st day after tumor implantation in the TCI group and TCI + Patch group. However, the application of Aitongping patch significantly increased the PWT and PWL compared with TCI group, suggesting Aitongping patch as an effective analgesic method to bone cancer pain in TCI mice. Moreover, no evident differences were found in respect to the mice PWT/PWL between the Sham group and the Patch group, thus ensuring the safety of Aitongping patch as the patch exerted no effect on the sham-operated mice.
The successful implantation of bone tumor reduced PWT and shortened PWL, while Aitongping patch increased PWT and extended PWL in TCI mice; (A) PWT decreased since the seventh day after tumor implantation in TCI mice; (B) PWL decreased since the seventh day after tumor implantation in TCI mice; (C) the application of Aitongping patch gradually increased PWT of TCI mice; (D) the application of Aitongping patch gradually increased PWL of TCI mice
Aitongping patch inhibits microglia activation in spinal cord of bone cancer mice
To verify the effect of Aitongping patch on the activation of microglia in the spinal cord, we detected the expression of microglial activation marker Iba1 in mice spinal cord collected on Day 0, Day 7, Day 14, and Day 21 after tumor implantation. Both the western blot results (Fig. 2A) and IHC results (Fig. 2B) indicated gradual upregulation of Iba1 protein, thus verifying that cancer pain could induce microglia activation in spinal cord. Moreover, when observing the effect of Aitongping patch on microglia activation in bone cancer mice, we found that the Iba1 expression was evidently activated in TCI group, and accordingly reduced in TCI + Patch group (Fig. 2C and D), thus indicating that Aitongping patch could inhibit microglia activation in mice spinal cord.
The successful implantation of bone tumor induced microglia activation by increasing Iba1 protein expression, while Aitongping patch restored microglia activation by suppressing Iba1 protein expression in TCI mice; (A) western blot assay of Iba1 protein on Day 0, Day 7, Day 14, and Day 21 after tumor implantation indicated gradual upregulation of Iba1 protein in TCI mice; (B) IHC assay of Iba1 expression on Day 0, Day 7, Day 14, and Day 21 after tumor implantation indicated gradual upregulation of Iba1 protein in TCI mice; (C) western blot assay of Iba1 protein showed decreased Iba1 protein levels in the TCI + patch group compared with the TCI group; (D) IHC assay of Iba1 expression showed decreased Iba1 expression in the TCI + patch group compared with the TCI group
Aitongping patch promotes the expression of miR-150-5p in bone cancer mice
To screen the miRNAs which may be involved in the cancer pain-related microglia activation in spinal cord, we searched relevant literature and found several candidate miRNAs which are reported to be dysregulated in mice with spinal nerve transection, mice with peripheral nerve injury, or rats with chronic constriction injury (Supplementary Table 4). These candidate miRNAs include miR-29c, miR-152, miR-101, miR-124-3p, miR-340-5p, miR-15a, miR-200b, miR-429, miR-34c, miR-26a-5p, miR-150-5p, and miR-136. We observed the changes in miRNA expression on Day 0, Day 7, Day 14, and Day 21 after tumor implantation (Fig. 3A–F), and found that only the expressions of miR-150-5p (Fig. 3D) were gradually reduced after tumor implantation. Furthermore, the fluorescence in situ hybridization (FISH) results (Fig. 3G) also validated the qRT-PCR results on miR-150-5p expressions, supporting the significant decrease of miR-150-5p expression along with cancer pain and promoted microglia activation. Moreover, the qRT-PCR (Fig. 3H) and FISH (Fig. 3I) results on all animal groups validated that Aitongping patch could restore the suppressed miR-150-5p expression in TCI mice.
Among all candidate miRNAs selected, only miR-150-5p was decreased since the successful bone tumor implantation, while Aitongping patch increased the inhibited miR-150-5p expression in TCI mice; (A) the relative expressions of miR-29c and miR-152 remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation; (B) the relative expressions of miR-200b and miR-429 remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation; (C) the relative expressions of miR-34c and miR-26a-5p remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation; (D) the relative expressions of miR-136 remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation, while the relative expressions of miR-150-5p exhibited a gradual decreased tendency; (E) the relative expressions of miR-340-5p and miR-15a remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation; (F) the relative expressions of miR-101 and miR-124-3p remained stable on Day 0, Day 7, Day 14, and Day 21 after tumor implantation; (G) FISH results showed gradually decreased miR-150-5p expression; (H) qRT-PCR analysis indicated that Aitongping patch could restore the cancer-induced decrease of miR-150-5p in TCI mice; (I) FISH analysis indicated that the Aitongping patch could restore the cancer-induced decrease of miR-150-5p in TCI mice
Aitongping patch inhibits the expressions of CXCL12 in bone cancer mice
By searching databases such as miRanda (http://www.microrna.org/microrna/home.do), RNAhybrid (https://github.com/maxiongma/demoData/blob/master/RNAhybrid.zip), and TargetScan (https://www.targetscan.org/vert_71), we predicted genes including SHISA4, TADA1, GDI1, HILPDA, CXCL12, and ABCB9 as potential target genes of miR-150-5p. We observed the expression of these genes on Day 0, Day 7, Day 14, and Day 21 after tumor implantation (Fig. 4A–C) and found that only the expressions of CXCL12 (Fig. 4C) were gradually increased after tumor implantation. Accordingly, the CXCL12 protein expressions detected by western blot (Fig. 4D) and IHC (Fig. 4E) were also gradually increased, showing a positive correlation with the changes in Iba1 expression in spinal cord. Moreover, when comparing the mRNA and protein expression of CXCL12 in different mice groups, we found that the evidently upregulated CXCL12 mRNA (Fig. 4F) and protein (Fig. 4G and H) in TCI mice were inhibited by Aitongping patch.
Among all the candidate target genes of miR-150-5p detected by miRanda, RNAhybrid, and TargetScan, only the expressions of CXCL12 mRNA and protein gradually increased after the successful tumor plantation. And the application of Aitongping patch decreased the highly expressed CXCL12 mRNA and protein in TCI mice; (A) qRT-PCR analysis indicated no fluctuations of SHISA4 and TADA1 mRNA expressions since tumor implantation; (B) qRT-PCR analysis indicated no fluctuations of GDI1 and HILPDA mRNA expressions since tumor implantation; (C) qRT-PCR analysis showed gradual upregulation of CXCL12 mRNA since the seventh day after tumor implantation, while the ABCB9 mRNA expression remained unchanged after tumor implantation; (D) western blot assay of CXCL12 protein showed gradually elevated CXCL12 expression since the seventh day after tumor implantation; (E) IHC assay of CXCL12 expression indicated gradual upregulation of CLXCL12 after tumor implantation; (F) qRT-PCR analysis indicated that the Aitongping patch could downregulate the increased CXCL12 mRNA level in TCI mice; (G) western blot assay of CXCL12 protein showed that the inhibited CXCL12 expression was increased by Aitongping application in TCI mice; (H) IHC assay of CXCL12 expression showed that the inhibited CXCL12 expression was increased by Aitongping application in TCI mice
CXCL12 could bind to miR-150-5p
As shown in Fig. 5A, results from sequence analysis demonstrated the presence of a potential binding site for miR-150-5p on the 3′UTR of CXCL12 mRNA. Accordingly, the results from subsequent luciferase assay showed that when compared to transfections with blank control or negative control miRNAs, the transfection of miR-150-5p mimics significantly reduced the fluorescence intensity of mouse primary microglia transfected with vectors carrying the wild-type CXCL12 3′UTR; however, it had no effect on the fluorescence intensity of mouse primary microglia transfected with vectors carrying the mutant CXCL12 3′UTR (Fig. 5B). The successful transfection of miR-150-5p mimics was confirmed by the overexpression miR-150-5p in mouse primary microglia (Fig. 5C). Accordingly, we found that the levels of CXCL12 mRNA (Fig. 5D) and protein (Fig. 5E) were significantly downregulated by miR-150-5p overexpression in mouse primary microglia.
Sequence analysis and luciferase assay confirmed the binding between miR-150-5p and CXCL12 mRNA. And the expressions of CXLC12 mRNA and protein were evidently decreased by the overexpression of miR-150-5p; (A) sequence analysis by TargetScan demonstrated potential binding site between miR-150-5p and CXCL12 mRNA 3′UTR; (B)compared with the transfection of blank control or negative control miRNAs, the transfection of miR-150-5p mimics significantly reduced the fluorescence intensity of mouse primary microglia transfected with vectors carrying wild-type CXCL12 3′UTR; (C) the successful transfection of miR-150-5p mimics was verified by the significant increase of relative expression of miR-150-5p; (D) qRT PCR analysis of CXCL12 mRNA indicated that the overexpression of miR-150-5p evidently inhibited the relative expression of CXCL12 mRNA; (E) western blot assay of CXCL12 protein indicated that the transfection of miR-150-5p mimics inhibited the relative expression of CXCL12 protein.
In vitro effect of Aitongping patch on microglia activation
To verify the in vitro effect of Aitongping patch on the microglia activation, we observed the expression of Iba1 in mouse primary microglia. As shown in Fig. 6, both the western blot (Fig. 6A) and immunofluorescence (IF) results (Fig. 6B) indicated that LPS activated the expression of Iba1 in mouse primary microglia, and Aitongping-treated serum significantly decreased Iba1 protein levels, thus indicating the in vitro inhibitory effect of Aitongping patch on microglia activation induced by LPS.
Iba1 protein in mouse primary microglia was increased by LPS, while the LPS-induced upregulation was restored by Aitongping-treated serum; (A) western blot assay of Iba1 protein in mouse primary microglia indicated that Aitongping-treated serum could suppress the LPS-induced upregulation of Iba1 protein in vitro; (B) IF results indicated that LPS activate Iba1 expression in mouse primary microglia, while Aitongping-treated serum significantly decrease Iba1 protein levels
In vitro effect of Aitongping patch on miR-150-5p and CXCL12 expressions
To verify the in vitro effect of Aitongping patch on microglia activation, we observed the relative expression levels of miR-150-5p and CXCL12 mRNA in mouse primary microglia stimulated with LPS for 0, 6, 12, 24, and 48 h. We found that the miR-150-5p levels (Supplementary Fig. 1A) were significantly decreased after LPS stimulation in a time-dependent manner, reaching the lowest expression at 24 and 48 h. Meanwhile, the CXCL12 mRNA (Supplementary Fig. 1B) and protein (Supplementary Fig. 1C and D) levels were significantly increased after LPS stimulation in a time-dependent manner, reaching the highest expression at 48 h. The changes in miR-150-5p and CXCL12 validated their participation in microglia activations in vitro. Furthermore, we compared the expression of miR-150-5p in different cell groups and found that the LPS-suppressed miR-150-5p was restored by Aitongping-treated serum treatment (Supplementary Fig. 1E). Moreover, in LPS-induced mouse primary microglia, the levels of CXCL12 mRNA (Supplementary Fig. 1F) and protein (Supplementary Fig. 1G and H) were evidently upregulated, while Aitongping-treated serum suppressed CXCL12 mRNA and protein expressions. Therefore, Aitongping has a significant inhibitory effect on the expression of CXCL12 in mouse primary microglia.
Discussion
Chronic pain is a complex phenomenon that can be caused by a variety of factors, including inflammation, nerve injury, and other changes in the central nervous system [20]. Although the anticancer treatment has been focusing on inhibiting tumor group and reducing tumor size for a long time, improving the quality of life of the cancer patients to the largest extend has been another focus in cancer management [21, 22]. Our study selected the EORTC QLQ-C30 scale to evaluate the quality of life of patients enrolled. Accordingly, we found that both anticancer treatment methods in the Patch and the Control group have greatly improved the patients’ quality of life, while the incidence of constipation in the Patch group was significantly lower than that in the Control group.
There have been many studies which validated that the CXCL12 signaling pathway is involved in pathological pain. CXCL12 signaling pathway not only regulates peripheral sensitization through the molecular regulatory mechanisms of neuronal and glial, but also promotes central sensitization through cellular processes such as neuroinflammation or interaction between neuron and glial [23]. Also, CXLC12 can directly activate sensory neurons or participate in the activation of sensory neurons in spinal dorsal horn [24], and blocking the CXCL12/CXCR4 signaling intrathecally can reduce the level of inflammatory cytokine to alleviate ischemia–reperfusion-induced inflammatory pain [25]. Moreover, in the management of cancer pain, studies have reported that the CXCL12/CXCR4 signaling pathway could participate in sensitization of neuron or the activation of astrocyte and microglia, which is crucial to the development and maintenance of bone cancer pain [26]. In this study, we found that in the TCI animal models, the relative mRNA and protein expressions of CXCL12 are evidently increased compared with the sham-operated mice, while the application of Aitongping patch significantly inhibited the elevation of CXCL12. Also, it is noteworthy that along with the highly expressed CXCL12, the tumor pain is successfully induced by tumor implantation, which is indicated by reduced paw withdraw threshold and shortened paw withdraw latency. Meanwhile, when the pain is alleviated by Aitongping patch application in the TCI + Patch group, the CXCL12 level is accordingly reduced. Therefore, our study suggested that the expression of CXLC12 is associated with the incidence and severity of pain, which is consistent with the findings proposed by previous publications.
Blocking the dysregulated activation of microglia has merged as a key antipain treatment method in cancer management [12]. Also, in respect to the chemical structure of noncoding miRNAs, many investigations have been performed to explore its potential for various disease treatment [27]. M1-like activation of microglia can exacerbate tissue injury and destruction, whereas M2-like activation of microglia can inhibit inflammation and promote tissue repair [28], suggesting the balance between proinflammatory M1-like phenotype and antiinflammatory M2-like phenotype as a treatment target for neural repair. In this study, we found several candidate miRNAs which might participate in the cellular processes involved in Aitongping treatment. Accordingly, we found that the expression of miR-150-5p was significantly reduced upon the onset of implanted tumors, while the treatment by Aitongping patch restored the downregulation of miR-150-5p. In previous studies which investigated the chronic sciatic nerve injury rat models, the upregulation of miR-150 has been reported to alleviate neuropathic pain development and inhibit expressions of inflammatory cytokines such as COX-2, IL-6, and TNF-α [10]. However, although both studies demonstrated the pain-relieving effects of miR-150, different signaling pathways were reported. Ji et al. reported the presence of a binding site for miR-150 located on TLR5 3'UTR that enables the binding between miR-150 and TLR5 3′UTR, and they also found that the targeting of TLR5 by miR-150 could mediate neuroinflammation [10]. Different from the above experiments, we found in our study that miR-150-5p could bind to the 3′UTR of CXCL12 mRNA, and the modulation of miR-150-5p/CXCL12 signaling pathway by the application of Aitongping patch could accordingly suppress the progression of cancer pain. To further support the mechanism of the Aitongping patch, we used serum-containing Aitongping to incubate mouse primary microglia cells and used LPS to activate the cells. The results confirmed that the serum containing the patch activated miR-150-5p and inhibited the activation of microglia cells.
Conclusion
Aitongping patch could alleviate cancer pain via suppressing microglia activation, and the downregulation of miR-150-5p, as well as the up-regulation of CXCL12 mRNA and protein, induced by tumor implantation or LPS stimulation, was restored by Aitongping treatment.
Conflict of interest statement
None declared.
Funding
This study is supported by Nantong Municipal Health Commission Scientific Research Project (No. QA2020054) and Nantong CM Medical Alliance Project (No. TZYK202132).
Authors’ contributions
Yunlong Chen planned the study and collected the literatures. Yunlong Chen and Mianhua Wu performed the experiments, collected and analyzed the data, and visualized the data. Yunlong Chen composed the manuscript, and Mianhua Wu improved the manuscript.
Data availability
Data are available from the corresponding author upon request.
