Evidence for a Role for NAD(P)H Dehydrogenase in Concentration of CO₂ in the Bundle Sheath Cell of Zea mays     Open Access

Abstract

One of the world’s highest-yielding crop species, Zea mays (“maize”), owes its success to the C₄ pathway of CO₂ assimilation. C₄ plants exhibit high rates of photosynthesis, use less nitrogen, and are drought-tolerant. This adaptation requires cooperation between two distinct, adjacent leaf cell types to accomplish concentration of CO₂ around ribulose bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) in the bundle sheath cell (BSC)—a capability absent in C₃ species. Understanding this mechanism would benefit efforts to engineer less efficient C₃ species such as the staple rice into C₄ plants (Jiao et al., 2009, von Caemmerer et al., 2012). Although the biochemical and structural features associated with BSC function in C₄ photosynthesis are now familiar, regulation of the ratio of CO₂ import/fixation, which relies on interactions of energy metabolism in the mesophyll cell (MC) and BSC, is not.

The main features of photosynthesis in NADP-ME (malic enzyme)-type species such as maize and sorghum have been well described (Edwards and Walker 1983, Zelitch et al., 2009). Atmospheric CO₂ is first fixed in the MC by carboxylation of PEP (phosphoenolpyruvate) to form OAA (oxaloacetate). The OAA is reduced to MAL (malate) and shuttled to the BSC chloroplast where the recently fixed CO₂ is released by ME. Pyruvate produced in this reaction returns to the MC and is used to regenerate PEP, completing the C₄ cycle. The CO₂ released in the BSC is refixed by carboxylation of RuBP as catalyzed by Rubisco to form PGA (3-phosphoglyceric acid). Thus, C₄ photosynthesis is an intrinsically C₃ process overlaid with a CO₂-pumping C₄ cycle leading to enhanced carboxylation of RuBP by Rubisco. The beneficial kinetic effect of high CO₂ is reinforced by competitive inhibition of Rubisco-catalyzed oxygenation of RuBP to produce glycolate-P and PGA (Laing et al., 1974, Ogren 2003). Glycolate-P is obligatorily metabolized with a detrimental release of CO₂ in the light (Somerville and Ogren 1979). This connection among RuBP, Rubisco, and O₂ was preceded by evidence that glycolic acid, an early product of photosynthesis, is in fact the substrate for photorespiration (Zelitch 1965, 2001). Reversal of the O₂-sensitivity of Rubisco (and synthesis of glycolate) highlights the significance of the C₄ pathway.

The MC and BSC compartments differ markedly in terms of carbon metabolism and reductant-generating capacities in NADP-ME C₄ species. Reduction of OAA to MAL and of PGA to triose-P in the MC is supported by an oxygenic electron transport system involving sequential turnover of photosystem II (PSII) and photosystem I (PSI) similar to C₃ mesophyll cells (Edwards and Walker 1983). On the other hand, most schemes of NADP-ME C₄ photosynthesis discount existence of PSII in the BSC. Indeed, a recent analysis of sources of F  _o-level Chl (chlorophyll) fluorescence in intact maize leaves suggested that PSI levels in the BSC and MC compartments are similar but cast real doubt as to the occurrence of PSII in the BSC (Peterson et al., 2014). Also, the level of Chl b, an antenna pigment predominantly associated with PSII, is depleted in the BSC of NADP-ME C₄ species (Edwards and Walker 1983). The apparent absence of water-splitting in the BSC is important since it emphasizes the important role of MAL as not only a transporter of CO₂ from the MC to the BSC, but also as a stoichiometric transporter of reducing equivalents originating in PSII of the MC chloroplast. The latter appears as NADPH in the BSC after oxidative decarboxylation of MAL by ME. The fate of this NADPH is consequential to operation of the Calvin cycle in the BSC. In this study, we explore the role of chloroplastic NAD(P)H dehydrogenase (NDH) in maize leaf photosynthesis with special consideration of its proposed function in concentration of CO₂ in the BSC.

A consensus model of plastid NDH structure and function is based on extensive biochemical and genetic work with C₃ Arabidopsis. The 1000-kD NDH supercomplex is comprised of five thylakoid membrane subcomplexes. At least 11 plastid and 25 nuclear genes encode NDH subunits and related protein factors in Arabidopsis (Ifuku et al., 2011, Peng et al., 2011). Serial disruption of several nuclear genes encoding structural subunits or assembly factors resulted in failed NDH supercomplex assembly and disrupted electron flow to PQ (plastoquinone) in the dark (Rumeau et al., 2005, Munshi et al., 2006, Ishihara et al., 2007, Ishikawa et al., 2008, Sirpiö et al., 2009, Takabayashi et al., 2009, Ifuku et al., 2010, Peng et al., 2010, Suorsa et al., 2010, Yabuta et al., 2010, Armbruster et al., 2013). Chloroplastic NDH has been assigned to a redundant NAD(P)H-dependent PSI cyclic electron transport pathway in C₃ plants (Nixon 2000). Tobacco deficient in NDH grew normally, but showed symptoms of reduced photoprotective capacity during water stress (Burrows et al., 1998). Likewise, linear electron transport rates in PGR5-deficient Arabidopsis were significantly reduced by simultaneous loss of NDH (Munekage et al., 2004). Early work indicated a probable similar plastid NDH organization and structure in maize (Funk et al., 1999). Maize MC and BSC plastid proteomes revealed expression of 23 NDH-associated components involving eight chloroplast and 26 nuclear gene homologs (Friso et al., 2010). Moreover, elevated expression of NDH in the maize BSC compared to the MC implies a special role with respect to fixation of CO₂ by the Calvin cycle (Takabayashi et al., 2005, Majeran et al., 2008, Friso et al., 2010). However, interpretations differ as to the nature of this role.

Plastid NDH catalyzes the reduction of PQ at the expense of NADPH potentiating PSI cyclic electron flow according to PQ → cytochrome f → plastocyanin (PC) → P700 → ferredoxin (Fd) → NADP. Takabayashi et al. (2005) proposed that an NDH-dependent cyclic electron transport pathway and associated Q-cycle turnover was the preferred means of producing adequate ATP for CO₂ fixation in the maize BSC as opposed to the conventional cyclic pathway involving reduction of PQ by Fd⁻. In contrast, the model proposed by Laisk and Edwards (2000, 2009) envisions linear BSC electron flow from MAL-derived NADPH, via PSI, to a separate NADP pool used by the Calvin cycle (Supplemental Fig. S1). The model emphasizes the stoichiometric constraints inherent in electron transport and H⁺-translocation [i.e. 12 H⁺/3 ATP; (Laisk et al., 2005)] in support of NADPH and ATP production by the MC-BSC system. Furthermore, exclusive coupling of production of these substrates to utilization by photosynthetic carbon metabolism supports stable CO₂ fixation, but CO₂ is not concentrated in the BSC. Conversely, imperfect coupling of ATP production to utilization by the Calvin cycle leads to an imbalance in MAL import versus CO₂ fixation in the BSC. Specifically, postulated leakage of ATP to non-photosynthetic processes (e.g. protein or starch synthesis) sets the stage for faster MAL import compared to CO₂ fixation, resulting in accumulation of CO₂ in the BSC. In the steady state, the CO₂ fluxes are balanced by passive diffusion of CO₂ from the BSC to the MC (CO₂ over-cycling). Hence, the likely competition for ATP between the Calvin cycle and alternate processes establishes a robust basis for sustained concentration of CO₂ in the BSC, which accounts for the diminished O₂-sensitivity in maize.

To our knowledge, this is the first experimental test of the Laisk-Edwards model. Specifically, we examined maize lines carrying mutations that disrupt expression of key chloroplastic NDH subunits. Interestingly, comparisons to Arabidopsis lines possessing lesions in homologous genes revealed the existence of a lesser, secondary NDH-like activity in maize leaves. Parallel measurements of CO₂ exchange and Chl fluorescence showed that the O₂-dependent linear electron flow that occurred in maize leaves was characteristic of photorespiration. Photorespiration in the mutant lines was elevated compared to normal lines, suggesting that CO₂ was less efficiently concentrated in the BSC compartment of the former. We conclude that the results support the proposed mechanism of Laisk and Edwards (2000, 2009) as a contributor to concentration of CO₂ in the BSC of NADP-ME type C₄ species.

RESULTS

Molecular Characterization of Maize NDH Lines

The 26 nuclear-encoded maize plastid NDH homologs identified by Friso et al. (2010) were screened in silico for transposon insertions using the Plant and Maize Genome Databases (www.plantgdb.org and www.maizegdb.org). A total of 16 insertions [2 Ds (Ahern et al., 2009) and 14 Mutator (Settles et al., 2007)] into nine NDH-related genes were found. Precise insertion loci were mapped using flanking and genomic sequence information. Transposon identity (Ds or Mu7) and insertion loci in field-grown plants were verified using oligonucleotides specific to the NDH gene and respective transposable element. Two lines were found to segregate transposon insertions in exons of single-copy genes encoding the critical O and N subunits of plastid NDH (Fig. 1, A and B). Thus, plants containing a normal allele (ZmNDHN) produced a 453-base-pair (bp) PCR fragment (Fig. 1A, lanes 1–5, 7) with primers NDHN1 and NDHN2. Plants carrying a Ds insertion allele (ZmNdhn) produced a 1-kilobase band using primers NDHN2 and Ds2 (lanes 2, 6, and 7). Likewise, homozygous normal (lane 1) and heterozygous (lane 2) plants possessing the ZmNDHO allele produced a 739-bp fragment using primers NDHOa and NDHOb. Insertion of Mu7 (ZmNdho) yielded a 300-bp fragment in heterozygous (lane 2) and homozygous segregates (lanes 3 and 4) using primers NDHOD and TIR8.4 (Fig. 1B). The genotypes were verified using independent primers as discussed in “Materials and Methods”. Seed of two self-fertilized siblings homozygous for the normal (ZmNDHO) and mutant (ZmNdho) alleles were used for characterization of growth chamber-grown plants. Individuals homozygous for Ds insertion (ZmNdhn) did not survive to the reproductive stage in the field. Hence, seed from a self-fertilized heterozygote was the source of normal and mutant siblings in laboratory studies. Seedlings were prescreened using the light-dark Chl fluorescence transient (Fig. 2). In a total of 57 progeny, 17 mutant plants were thus identified consistent with Mendelian segregation of the ZmNdhn allele.

Figure 1.

Genotypic analysis of ZmNDH alleles. A, The genomic structure of the ZmNDHN locus is depicted with bars representing exon sequences and lines representing introns. The gray triangle represents Ds insertion (I.S07.1657_JSR05) into exon 2. Specific oligonucleotide primer orientation and positions N1 (NDHN1), N2 (NDHN2), and transposon-specific Ds (DsSeq2) are shown. Gels show DNA fragments amplified from genomic DNA isolated from plants 1 to 7 with primers N1 and N2 (453 bp) or N2 and Ds (1 kb). B, The genomic structure of the ZmNDHO locus is shown in which the gray triangle represents Mu7 insertion (Mu1016286) into exon 2. Specific primer orientation and positions a (NDHOA), b (NDHOB), and d (NDHOD), and Mu7-specific 8 (TIR8.4), are shown. Gel represents amplified DNA fragments from genomic DNA isolated from plants 1–4 with primers a and b (739 bp) or d and 8 (300 bp). C, Light photomicrography of leaf cross sections from ZmNDH (normal or wild-type) and ZmNdh mutant lines. BSCs are arranged radially around vascular elements. The latter are surrounded by MCs in contact with stomatal openings. Scale bar refers to 20 μm. See text for further details.

Open in new tabDownload slide

Figure 2.

Light-dark fluorescence transients for normal and NDH mutant lines of maize and Arabidopsis. Leaf tissue was pre-illuminated at a WL  PFD of 100 μmol quanta m⁻² s⁻¹ in normal air (400 μL CO₂ L⁻¹, 21% O₂) until F_s was stable. (Black traces) The WL was interrupted at time zero. (Red traces) Same as for the black traces, but FRL (50 μmol quanta m⁻² s⁻¹) was superimposed on the WL. The FRL was interrupted 5 s after darkening.

Open in new tabDownload slide

Fundamental Properties of NDH-Deficient Maize and Arabidopsis

Under growth chamber conditions, NDH-deficient maize seedlings exhibited marginally visible slower growth and paleness compared to normal sibling lines (Supplemental Fig. S2). Table I shows that loss in expression of ZmNDHO or ZmNDHN resulted in a statistically significant 25% to 35% reduction in total Chl and Car (carotenoid) contents. Not surprisingly, the absorbance of white light (WL) was also reduced in the mutant lines. Microscopy showed that both mutant lines were depleted in chloroplasts relative to normal siblings (Fig. 1C). The average quantum yield of PSII after full (12 h) dark-adaptation (F_v/F  _md) was lowered by 5% to 6% in the maize mutants, which may result from slight photoinhibition during growth. Large deficits in CO₂-saturated CO₂ assimilation rates at two incident photon flux density (PFD) levels were observed in these mutants relative to normal controls (see also Fig. 3). Interestingly, a substantial reduction in dark respiration suggests that the NDH complex donates electrons to the maize chlororespiratory system. No significant effects of loss of the NDHO subunit in Arabidopsis on the above parameters were observed. Likewise, no significant NDH-dependent difference in CO₂ assimilation was observed in Arabidopsis at a PFD of 100 μmol quanta m⁻² s⁻¹ in normal air (270 μm O₂, 14.2 μm CO₂, 23°C).

Effect of NDH genotype on several photosynthetic parameters in leaf tissue of maize and Arabidopsis

Figure 3.

The relationship between net carbon assimilation rate (A) and the MC wall CO₂ concentration (C_m) at 2% and 21% O₂ for normal and NDH mutant maize leaf tissue. The WL  PFD level was 750 μmol quanta m⁻² s⁻¹ and the leaf temperature was 30°C. Error bars indicate mean ± se.

Open in new tabDownload slide

Studies with Arabidopsis and tobacco have shown that failure to form an active chloroplast NDH complex results in a characteristic change in the kinetics of Chl fluorescence in response to darkening (Burrows et al., 1998, Rumeau et al., 2005, Munshi et al., 2006, Ishihara et al., 2007, Ishikawa et al.2008, Peng et al., 2009, Sirpiö et al., 2009, Takabayashi et al., 2009, Suorsa et al., 2010, Yabuta et al., 2010). Figure 2 compares this light-dark transient for the maize mutants ZmNdho and ZmNdhn and respective normal sibling controls. Upon interruption of WL, normal maize and Arabidopsis leaves similarly showed an immediate drop in fluorescence yield followed by a slower rise to levels that often exceeded the steady-state levels observed in the light. Subsequently, the signal decayed on a time scale of minutes. The post-illumination fluorescence rise was completely suppressed in the corresponding Arabidopsis mutant lines (AtNdho and AtNdhn). Interestingly, although fluorescence declined abruptly in the maize mutants upon darkening, the ensuing rise was not diminished to the extent seen in the Arabidopsis mutants. Addition of far red light (FRL, 720 nm, 50 μmol quanta m⁻² s⁻¹) to preferentially excite PSI for 5 s after darkening always delayed and attenuated the fluorescence rise. This confirmed that the rise in fluorescence was associated with accumulation of electrons in the inter-photosystem PQ pool leading to partial closure of PSII.

Interactive Effects of O₂, CO₂, and Maize NDH Genotype

Table II summarizes effects on the MC  PSII light utilization parameters of nonphotochemical quenching of excitation [NPQ = (F  _md – F_m)/F_m], fraction of photochemically competent (open) PSII units [qP = (F_m – F_s)/(F_m – F_o)], and intrinsic PSII quantum yield (F_v/F_m) as well as stomatal (g_s) and total mesophyll (liquid phase plus enzymic, g_m) values of conductance to CO₂. Data were obtained from the CO₂ response experiments of Figure 3. Variation in these parameters was assessed for each line by 2-way (O₂ versus CO₂) ANOVA. A statistically significant [i.e. p (probability) < 0.05] main effect of O₂ was most consistently observed for F_v/F_m but the differences were modest. For instance, lowering the O₂ concentration from 21% (v/v) to 2% resulted in an 8% versus 12% decline in mean F_v/F_m for ZmNDHO and ZmNdho, respectively. The corresponding O₂-dependent declines associated with disruption of expression of ZmNDHN were 7% and 17%, respectively. Similarly, O₂ exerted significant, yet small, effects on stomatal conductance (g_s) in the maize NDH mutant lines only, suggesting interaction between O₂ level and NDH expression with respect to guard cell function. Of greater interest were the consistently significant effects of genotype on PSII parameters qP and NPQ. Loss of ZmNDHO or ZmNDHN expression resulted in a 36% and 27% reduction in photoprotective NPQ, respectively. Not surprisingly, CO₂ exerted a strong main effect on PSII light utilization parameters (also g_s) but this effector often interacted with genotype. No significant differences in g_m were detected in mutant relative to corresponding normal leaves. Importantly, Tables I and II show consistency over a range of properties for the two independently created maize lines under study, which lack expression of distinct subunits essential for assembly of an active NDH supercomplex (Fig. 1). We conclude that neither phenotype is a spurious result of a cryptic mutation linked to the insertion site.

Effects of NDH genotype, O₂, and CO₂ on maize leaf conductances to CO₂ diffusion and PSII light utilization parameters

Although O₂ consistently affected the PSII light utilization parameter F_v/F_m (Table II), no statistically significant (i.e. P > 0.05) effect of O₂ on net CO₂ assimilation rate (A) at a high PFD occurred for the four datasets of Figure 3 based on 2-way (O₂ versus CO₂) ANOVA. Despite similarity in the initial slopes of A versus MC wall CO₂ molarity (C_m) plots (g_m; Table II), the linear increase in A extended to higher C_m levels in the normal lines establishing plateaus approximately twice those observed for the mutants.

Also evident in Figure 3 is that the value of C  _m at which A = 0 (the CO₂ compensation point, ½) did not change appreciably with either genotype or O₂ level. Additional CO₂ response measurements were conducted at five O₂ levels ranging from 11 μM to 454 μM (data not shown). Values of ½ for all maize lines were extremely low and difficult to measure precisely. Mean ½ values ranged from 0.008 μM to 0.023 μM CO₂ and 2-way ANOVA indicated no significant effect of O₂. Conversely, normal and NDHO-deficient Arabidopsis leaves showed highly significant, and identical, linear increases in ½ with an O₂ level similar to that commonly observed in C₃ plants (Laisk and Oja 1998).

NDH Genotype and Dark Reduction of P700⁺

Based on the postulated role of plastid NDH in transferring electrons from NAD(P)H to PQ, we considered that the kinetics of reduction of PC⁺ and P700⁺ post-FRL treatment could be slower in NDH mutants. An example of the decline in ƊA  ₈₁₀ (a measure of these cation levels) in normal and mutant leaves are shown in Figure 4. The transients fitted well to a sum of exponential terms

(1)

where t is time since darkening; the sum of amplitudes K  ₁ and K  ₂ is the steady-state absorbance signal change in FRL relative to darkness; and t_{c  1} and t_{c  2} are time constants. No significant (P > 0.05, n = 3) effect of genotype was observed for the ZmNDHO/ZmNdho system. Mean (± se) values of K  ₁, t_{c  1}, and t_{c  2} were 80.6% ± 1.6, 1.78 s ± 1.2, and 0.27 s ± 0.02, respectively. Results were similar for ZmNDHN/ZmNdhn except that t_{c  1} was significantly (P < 0.05) longer for mutant compared to normal leaf tissue (1.86 s ± 0.09 versus 1.16 s ± 0.28). For the AtNDHO/AtNdho system, K  ₁ was larger but did not differ across genotypes (92.7% ± 0.9). Nevertheless, t_{c  1} increased by a small degree from 2.63 s ± 0.22 for normal leaves to 3.33 s ± 0.16 for the mutant line (P < 0.05, n = 4).

Figure 4.

Kinetics of the decline in the in vivo 810-nm absorbance signal for normal and mutant maize. Pre-illuminated leaves were subjected to 10 s of WL (1000 μmol quanta m⁻² s⁻¹) followed by 4 s of FRL (50 μmol quanta m⁻² s⁻¹) then darkness (time zero in the figure). Data points were recorded at 3-ms intervals. Each trace is an average of six transients. The fine lines at the bottom of the figure are residuals plots displaced from zero for clarity.

Open in new tabDownload slide

Allocation of Linear Electron Flow to O₂-Dependent Processes in Maize

Impaired ability to concentrate CO₂ in the BSC of maize NDH mutants should be manifested as enhanced photorespiration since Rubisco and the glycolate-metabolizing pathway are confined to this compartment (Edwards and Walker 1983, Majeran et al., 2008, Friso et al., 2010). Although the results of Figure 3 offer no evidence for significant photorespiration (i.e. Warburg effect) in any line, O₂-dependent shifts in linear electron transport rate (ETR) have been observed (Peterson 1989, 1990, 1991, 1994), confounding assessments of O₂-sensitivity based on CO₂ assimilation alone. Chl fluorescence measurements, performed in parallel with CO₂ and H₂O exchange measurements of Figure 3, enabled independent assessment of PSII photochemical yield [(F_m − F_s)/F_m = ƊF/F_m, Genty et al., 1989]. Two-way ANOVA (O₂ versus CO₂) indicated that CO₂ was consistently the dominant source of variation in ƊF/F_m and J_c (= 4 × A) based on sum-of-squares partitioning. Nevertheless, the main effect of O₂ on ƊF/F_m was also statistically significant (P < 0.01) for both ZmNDHO and ZmNdho. However, the sum-of-squares apportioned to O₂ was much larger (5.13%) for mutant compared to normal leaves (0.60%). As noted above for A, the main effect of O₂ on J_c was not significant (P > 0.05) for either genotype. Results were similar for ZmNDHN and ZmNdhn. This preliminary analysis provided a strong indication of greater allocation of total PSII  ETR to photorespiration for the NDH mutants. We next quantified the O₂-dependent fraction of total PSII  ETR, which enabled estimation of the CO₂ level at the Rubisco catalytic sites.

Figures 5 and 6 show the responses of ƊF/F_m and J_c to increases in C_m for normal (ZmNDHO) and mutant (ZmNdho) maize leaf tissue, respectively. As a theoretical basis, the total linear ETR (J_T) is related to ƊF/F_m by

(2)

where a  ₂ is the fraction of the photosynthetic absorption density (PAD, μmol quanta m⁻² s⁻¹) of WL allocated to PSII (Genty et al., 1989). The parameter J_T encompasses all sinks for PSII-generated reductant: net fixation of CO₂ (J_c), photorespiration (J_o), and collective alternate processes such as n-metabolism (J_a) so that J_T = J_c + J_o + J_a. Both figures show that, at high PAD, J_c and ƊF/F_m rise similarly with C_m, implying that J_c > > J_o + J_a. As noted above, enhancement of ƊF/F_m by elevation of the O₂ level is clearly evident for mutant (Fig. 6) and, less dramatically, normal leaves (Fig. 5). We neglect J_o at 2% O₂ (23 μM). Thus, for a fixed C_m, stimulation of J_o caused by an increase in O₂ level from 2% to 21% (237 μM) was associated with an increase in ƊF/F_m disproportionately larger than any coincidental increase in J_c.

Figure 5.

Relationships of J_c (circles) and ƊF/F_m (squares) to C_m for normal maize. Measurements were performed in 2% O₂ (white fill) or 21% O₂ (black fill). The inset shows the initial portions of the full CO₂ response datasets (main panel). The arrow in the inset illustrates how J_o at ½ (21% O₂) is estimated from the equivalent C_m (at 2% O₂) wherein the associated ƊF/F_m coincides with the y intercept of the 21% O₂ plot.

Open in new tabDownload slide

Figure 6.

Relationships of J_c (circles) and ƊF/F_m (squares) to C_m for the maize ZmNdho mutant. See Figure 5 for definition of symbols. Note the relatively larger effect of O₂ on ƊF/F_m compared to ZmNDHO (Fig. 5) resulting in a distinct lack of overlap between the 2% and 21% O₂ datasets at C_m levels > 2.0 μM.

Open in new tabDownload slide

Several relevant features of the CO₂-dependencies of ƊF/F_m and J_c (Figs. 5 and 6) are noted. First, under conditions of CO₂ limitation, increases in ƊF/F_m and J_c with C_m are linear, which simplifies analysis. Second, the plots of J_c at low and high O₂ are virtually coincident and extrapolate to the origin consistent with negligibly low, dark respiration in the light. Third, the slopes of the ƊF/F_m versus C  _m plots clearly differ and tend to converge as C_m increases, consistent with a CO₂-reversal of the O₂ effect. Fourth, an extrapolated finite value of ƊF/F_m remains at 2% O₂ when C_m = 0, which we ascribe to J_a. Fifth, since CO₂-response measurements were conducted at both O₂ levels for each test leaf, the analyses of O₂-dependent PSII  ETR allocation were not subject to leaf-to-leaf or genotypic differences in a  ₂ (Eq. 2).

The principle behind quantification of allocation of PSII  ETR to photorespiration versus net fixation of CO₂ is illustrated in the inset to Figure 5. In the special case of the CO₂ compensation point (½ ≈ 0.015 μM), the increase in the y intercept of the ƊF/F_m versus C_m plot at 21% O₂ versus 2% O₂ is an estimate of PSII photochemical yield associated with photorespiratory C-recycling when J_c = 0. Translation of this value to the ƊF/F_m plot at 2% O₂ corresponds to a C_m of 0.24 μM. The latter is associated with a J_c of 6.4 µmol e⁻ m⁻² s⁻¹, which, in turn, is J_o at ½ (21% O₂). The regression fits to the data of Figure 5 were likewise used to generate a continuous profile of J_o (21% O₂) up to a C_m of 1.90 μM, where J_c + J_o was 53.8 μmol e⁻ m⁻² s⁻¹ and J_o was 2.3 μmol e⁻ m⁻² s⁻¹. For ZmNdho (Fig. 6), better fits were obtained using exponential functions. At ½ in 21% O₂, J_o was 8.0 μmol e⁻ m⁻² s⁻¹, falling to 5.3 µmol e⁻ m⁻² s⁻¹ at 1.55 μM CO₂. With strict reference to photosynthetic carbon metabolism, we define the ratio of dissipative ETR relative to the total as J_o/(J_c + J_o) = P  _diss (Peterson 1989, 1990, 1994). Thus, for normal leaves, P  _diss (in 21% O₂) falls from 1.00 at ½ to 0.042 at C_m = 1.90 µM. Interestingly, P  _diss for the mutant at C_m = 1.55 μM is a significantly higher value of 0.150.

The method just described was effective at low C_m values due to highly overlapping ranges of J_c and ƊF/F_m at 2% and 21% O₂ for both normal and mutant leaves. These overlaps allowed reliable assignment of J_c + J_o at 21% O₂ over a continuous C_m range by relating ƊF/F_m to J_c data obtained at 2% O₂. But Figures 5 and 6 clearly show that at C_m values that exceed 1.9 μM for normal, and 1.55 μM for mutant leaves, the magnitudes of ƊF/F_m and J_c in 21% O₂ progressively exceed, and no longer overlap, the corresponding ranges in 2% O₂, rendering evaluation of J_c + J_o at 21% O₂ impractical. A modified method was adopted to estimate P  _diss at higher C_m values. Equation 2 predicts linearity between J_T/PAD and ƊF/F_m. In practice, curvilinear relationships have been observed over wide ranges of ƊF/F_m (Peterson et al., 2001; Peterson 1994). Over short intervals, however, increases in J_T/PAD with ƊF/F_m approach linearity. J_T was estimated as J_c + J_a, which is valid at 2% O₂ (since J_o ≈ 0) but only provisional at 21% O₂ (since J_o may be significant). The magnitude of J_a was estimated by applying the y intercepts of plots of ƊF/F_m versus C_m at 2% O₂ to the corresponding dependencies of J_c on C_m (as described above, see inset to Fig. 5). Figure 7 shows highly positive (J_c + J_a)/PAD versus ƊF/F_m relationships for normal and mutant leaves. Significantly, the regression fits at 21% O₂ fell below those for 2% O₂, consistent with an unaccounted-for contribution of J_o to J_T at the higher O₂ level (Peterson 1989, 1990, 1994). This O₂-dependent shift was relatively greater for the mutant. This empirical approach allowed calculation of P  _diss as

(3)

where the subscripts refer to 2% O₂ and 21% O₂. Estimates of P  _diss (Eq. 3) for C_m > 1.55 μM were generated from predicted values of (J_T/PAD)₂ and (J_T/PAD)₂₁ by substitution of ƊF/F_m values observed at 21% O₂ into the regression equations in Figure 7. Values of J_a/PAD were 0.0274 and 0.0181 for normal and mutant datasets, respectively.

Figure 7.

Relationships of (J_c + J_a)/PAD versus ƊF/F_m at 2% (solid lines) and 21% O₂ (dashed lines) for normal and mutant maize. See Figure 5 for definition of symbols. Note the high fidelity of the first- and second-order polynomial regression fits (R  ² = coefficient of determination) to the mean data points and the relatively larger separation between the fits for mutant compared to normal leaves. These fits enable empirical estimation of P  _diss in 21% O₂ by referring the associated ƊF/F_m to the regression equations to evaluate [(J_c + J_a)/PAD]₂ and [(J_c + J_a)/PAD]₂₁ (Eq. 3). See text for additional information.

Open in new tabDownload slide

Figure 8 shows the broad changes in P  _diss with C_m for ZmNDHO and ZmNdho in 21% O₂. Surprisingly, the magnitude of P  _diss for normal and mutant leaves does not differ for C_m < 0.6 μM. For C_m > 0.6 μM, P  _diss declines progressively in both normal and mutant leaves but is consistently higher for the latter. Corresponding values of the BSC CO₂ concentration (C_b, μM) were calculated using the Rubisco model and conservative assumptions pertaining to metabolism of glycolate (Peterson 1989, 1990, 1994):

(4)

where O_b is the O₂ concentration in the BSC (237 μM) and K  _sp is the dimensionless Rubisco CO₂/O₂ specificity factor (Jordan and Ogren 1981). We employed a K  _sp value of 75 at 30°C based on unpublished measurements in this laboratory of the temperature- and O₂-dependencies of ½ in C₃ Arabidopsis and Nicotiana benthamiana (see Laisk and Oja, 1998). We emphasize that results obtained using the ZmNDHN/ZmNdhn pair were similar to the results obtained for ZmNDHO/ZmNdho (Fig. 8). Since the Calvin cycle in the maize BSC is an essential step in net carbon accumulation, a positive relationship between A and C_b is anticipated. Indeed, Figure 9 shows that A rose curvilinearly with C_b in normal leaves, suggesting that Rubisco activity became progressively limiting at the higher external CO₂ levels employed. Moreover, A in the mutant lines increased linearly with C_b in parallel with the rises observed for normal leaves and the lower maxima (Table I; Fig. 3) were due to an inability to increase C_b to levels attainable in normal leaves.

Figure 8.

Changes in the fraction of total PSII linear electron transport diverted to photorespiration (P  _diss, Eq. 3) and the calculated CO₂ concentration in the BSC (C_b, Eq. 4) for lines ZmNDHO and ZmNdho. The discontinuity in the traces near C_m of 1.55 μM arises from the different methods used to derive results. Specifically, traces for the lower C_m range were obtained using the approach associated with Figures 5 and 6, where substantial overlap in ƊF/F_m at 2% and 21% O₂ occurred for normal and mutant leaves (see text). Data points (circles and squares) at higher measured C_m values were obtained using the regression equations from Figure 7. Note that NDH genotype does not affect P  _diss at C_m < 0.6 μM. See text for further information.

Open in new tabDownload slide

Figure 9.

Comparisons of A versus C_b for the maize NDH subunit O and N mutants and associated normal lines.

Open in new tabDownload slide

CO₂ Exchange Transients Confirm Elevated Photorespiration in Maize NDH Mutants

We observed that during brief interruptions of actinic WL associated with estimation of F_o, the kinetics of recovery of A once the illumination was restored showed a distinct effect of O₂ in the mutant lines only. Figure 10 shows examples of the recovery of A in the light for ZmNDHO and ZmNdho at 2% and 21% O₂. Although the extents of change in A differ between these lines, the kinetics of recovery were similar for the mutant at 2% O₂ and normal leaves at both O₂ levels. However, in 21% O₂, the kinetics for the mutant showed a distinct oscillation, resulting in a slower recovery due possibly to reduction of photorespiratory PGA in the MC (Laisk and Edwards 2009). We compared these changes in terms of the transient complementary area (CA) as shown in Figure 10. Transients in CO₂ exchange were not detected at C_m < 0.7 μM. Figure 11 shows that CA increased rapidly at higher C_m values, saturating at 4 μM to 6 μM. The ratio of CA in 21% relative to 2% O₂ was close to unity for normal leaves over the entire range of C_m investigated. Conversely, this ratio was twice as high for the mutant. Results obtained for the ZmNDHN/ZmNdhn pair were similar to those shown in Figures 10 and 11.

Figure 10.

Interactive effects of genotype and O₂ level on the time course of A during recovery following a 7 s dark interval. Note the distinctly slower recovery at 21% O₂ compared to 2% O₂ in the mutant. The complementary area (cross-hatched) is the sum of the difference between the final rate at full recovery and average A over successive 1 s time intervals.

Open in new tabDownload slide

Figure 11.

The CA increased with increasing C_m reflecting complex shifts in production of NADPH and ATP relative to consumption of these substrates during the dark-light interval (top panel). Nevertheless, the CA in 21% O₂ was generally twice that observed at 2% O₂ for the mutant, but relatively unaffected by O₂ concentration in normal leaves (bottom panel).

Open in new tabDownload slide

DISCUSSION

Chloroplastic NDH appears to be common in higher plants, but the precise function and regulation of this complex remains obscure. Current opinion holds that NDH catalyzes electron flow from NAD(P)H to PQ in support of a dark respiratory process (chlororespiration) and dissipation of excess stromal reductant (Nixon 2000). Coupling of H⁺-translocation to NDH turnover has led to a proposed role in PSI-dependent cyclic photophosphorylation (Shikanai et al., 1998, Munekage et al., 2004, Livingston et al., 2010, Ifuku et al., 2011). Numerous phenotypic characterizations in Arabidopsis and tobacco have established that under mild conditions of growth, NDH is dispensable (Burrows et al., 1998, Shikanai et al., 1998, Horváth et al., 2000, Rumeau et al., 2005). Indeed, the most commonly used indicator of loss/impairment of NDH function is the absence/diminution of the post-illumination F_o-rise associated with reduction of the inter-photosystem PQ pool (Fig. 2). A relevant, yet enigmatic, criterion of dispensability relates to the kinetics of reduction of P700⁺ and PC⁺ after FRL treatment. Available reports describe only modestly slower decay kinetics for the 810-nm absorbance signal in nonstressed NDH-deficient lines (Burrows et al., 1998, Sazanov et al., 1998, Sirpiö et al., 2009). We observed a slightly higher time constant for decay of the 810-nm signal for the Ndho mutant of Arabidopsis, but were unable to detect any significant effect of NDH mutation in maize (Fig. 4). Assuming that loss of the o- or n-subunit results in a lack of accumulation of the NDH supercomplex (Rumeau et al., 2005, see also results for Arabidopsis in Fig. 2), it is significant that a reduced, yet substantial, F_o-rise persists in the maize mutants (Fig. 2). Together these observations suggest that electrons can flow from the PSI acceptor side to PQ via multiple pathways. This is supported by reports of an Fd-dependent mechanism involving PGR5 in PSI (Munekage et al., 2002, 2004) and a psaE-dependent cyclic pathway (Yu et al., 1993). However, the simple notion of parallel pathways of dark PQ reduction is confounded by report of an Fd-binding site in the NDH complex (Yamamoto et al., 2011) and that, in chloroplast preparations, NDH turnover requires Fd (Munekage et al., 2004, Peng et al., 2009, Suorsa et al., 2009).

In contrast to weak NDH-deficient phenotypes in the C₃ systems studied, we observed: (1) slower growth and photosynthesis and reduced pigment levels for maize NDH mutant compared to normal lines (Table I); and (2) significant effects on indicators of PSII function (Table II). Several studies of the effects of water stress (Horváth et al., 2000, Munné-Bosch et al., 2005), temperature stress (Sazanov et al., 1998, Li et al., 2004, Wang et al., 2006), and light stress (Endo et al., 1999) show stronger NDH-deficient phenotypes, consistent with an important role for NDH-dependent cyclic electron flow in production of ATP after stress treatment. Interestingly, stress treatment restored the F_o-rise in NDH-deficient leaves (Sazanov et al., 1998, Munné-Bosch et al., 2005, Wang et al., 2006). The apparent sensitivity of the latter to antimycin A implies that the Fd-dependent PGR5 pathway was active under these conditions (Munné-Bosch et al., 2005). Thus we suggest that the maize NDH-deficient phenotype could be a secondary consequence of the much lower BSC CO₂ concentrations attainable for these lines (Fig. 9). Specifically, lower F_v/F  _md and pigment content is consistent with chronic photooxidative stress associated with excess illumination (Endo et al., 1999). We estimate that growth of the mutant lines in normal air (400 μl CO₂  l  ⁻¹, 21% O₂) in this study could be equivalent to growth of normal lines at a CO₂ level of 60 to 100 μl CO₂  l  ⁻¹ (Figs. 3 and 9). Lower values of qP (Table II) and ƊF/F_m (Figs. 5–7) for the mutant lines are commonly associated with reduced CO₂ assimilation capacity (Peterson 1989, 1990, 1991).

The utility of variable Chl fluorescence as a tool in interpreting downstream changes in CO₂ assimilation in maize attests to highly integrated and connected MC/BSC function during photosynthesis such that reduced consumption of ATP and NADPH in the BSC, due to limited CO₂ availability, is transmitted to the MC resulting in down-regulation of PSII photochemical yield. Likewise, a close correspondence between CO₂ assimilation and oxygenic PSII turnover was observed over a wide range of irradiances and CO₂ levels in the C₄ NAD-ME species Amaranthus edulis (Kiirats et al., 2002). An unexpected result in this study was the lower mean NPQ (Table II) for the mutants, illustrating that a NDH-dependent H⁺-translocating cyclic pathway could contribute to ƊpH formation in the MC chloroplast necessary for photoprotective quenching. Alternatively, lower mean steady-state F_v/F_m (and NPQ) values for the mutants (Table II) may not be exclusively associated with lower reversible quenching of F_m, but rather, due in part to increased levels of invariant emission (F_c) resulting from accumulation of nonfunctional PSII units (Peterson et al., 2014).

Plants employing the C₄ photosynthetic mechanism typically exhibit O₂-insensitive carbon assimilation and very low CO₂ compensation points (½) compared to C₃ types. Nevertheless, since Rubisco turnover in the BSC is essential to the C₄ mechanism, some photorespiration must occur when O₂ is present—consistent with the mutual competition between O₂ and CO₂ at the enzyme active site (Lorimer and Andrews 1973). Indeed, a high level of glycolate oxidase (the initial step in the photorespiratory pathway) is required for survival of Zea mays in normal air (Zelitch et al., 2009). The seeming paradox of a low, O₂-independent ½ and occurrence of measureable O₂-dependent (and CO₂-reversible) linear electron transport reported here for normal and mutant maize can be addressed in terms of the compartmentation inherent in the MC-BSC model. As pointed out by Laisk and Edwards (2000, 2009), under the equilibrium conditions of ½ (i.e. A = 0 and P  _diss = 1.00) the CO₂ level in the BSC equals that which would occur at the same ambient O₂ level and temperature in a C₃ mesophyll cell. We estimate that at compensation in 21% O₂ and 30°C, the CO₂ concentration in the BSC is 1.6 μM and essentially zero in the MC. The corresponding linear ETR in the MC of ZmNDHO is 6.4 μmol e⁻ m⁻² s⁻¹, equivalent to a maximum potential CO₂ fixation rate of 1.6 μmol CO₂ m⁻² s⁻¹. Thus, the maximal conductance for CO₂ diffusion from the BSC to the MC (CO₂-overcycling) is only 1.0 mm s⁻¹ (g  _bsc) and likely to be much smaller, since some of the linear electron flow in the MC could be used for reduction of PGA (Laisk and Edwards 2009). This upper limit for g  _bsc is less than one-seventh of the magnitude of g_m in the MC (Table II). A study with A. edulis mutationally or chemically blocked in C₄ cycle function likewise showed conditionally higher rates of O₂-dependent PSII linear electron transport (photorespiration) compared to controls and a similarly low conductance to CO₂ diffusion from the MC to sites of CO₂ fixation by Rubisco in the BSC (Kiirats et al., 2002). Furthermore, in this study J_o at ½ is <0.08 of the CO₂-saturated J_T (Table I). A corresponding estimate of J_o/J_T at ½ in tobacco was at least 0.5 (Peterson 1989). Thus, photorespiration is indeed suppressed in C₄ relative to C₃ leaves due, in part, to the critical function of the BSC wall in restricting over-cycling of CO₂ to the MC (Kiirats et al., 2002).

An important and original result presented here is that photorespiration is elevated in NDH-deficient maize compared to normal maize, over a wide range of MC CO₂ levels (Fig. 8). We interpret the lag in recovery of steady-state CO₂ assimilation after transient darkening in NDH mutants (Figs. 10 and 11) as diversion of NADPH and ATP from fixation of external CO₂ to processing of photorespiratory CO₂, PGA, and NH₃ (Ogren 1984). Since Rubisco, the Calvin cycle, and the photorespiratory pathway are localized in the BSC (Majeran et al., 2008, Friso et al., 2010), quantification of P  _diss enabled assessment of C_b in conjunction with C_m. Most important, plots of A versus C_b coincide for normal and mutant siblings (Fig. 9), implying that genotypic differences in A versus C_m (Fig. 3) are fully accounted for in terms of the differing capacities for concentration of CO₂ in the BSC. Impaired capacity to generate ATP in the BSC of NDH-deficient maize is associated with depressed processing of MAL by ME due to restricted utilization of product NADPH. This results in slower turnover of the C₄ cycle and reduced concentration of CO₂ around Rubisco. Despite apparent occurrence of mild photooxidative symptoms in the mutant lines, genotypic differences in g_s or g_m were respectively minor or absent (Table II). Thus, neither stomatal aperture nor enzymic prerequisites for CO₂ assimilation differed substantially in the normal and mutant lines. The question arises as to how NDH enables CO₂ accumulation corresponding to respective C_b/C_m molarity ratios of 19 and 37, and equilibrium BSC gas phase CO₂ concentrations of approximately 5000 μl  l  ⁻¹ in ZmNDHO and approximately 8700 μl  l  ⁻¹ in ZmNDHN during growth in normal air (12 μM CO₂) at 30°C (see Figs. 3 and 9).

Carbon dioxide fixation in the BSC of NADP-ME type C₄ species requires 2 ATP for each NADPH consumed (Supplemental Fig. S1; Laisk and Edwards 2000, 2009; Takabayashi et al., 2005). The Laisk-Edwards model postulates a channeled NDH-catalyzed reduction of PQ by NADPH produced by ME turnover. Proton translocation during sequential electron flow from NADPH to PSI, via PQ and cytochrome f, satisfies the BSC ATP/NADPH requirement. However, modest diversion of ATP to non-photosynthetic processes (e.g. protein or starch synthesis) or processing of photorespiratory products in the BSC leads to import of CO₂ at a rate slightly faster than the ATP-limited rate of carboxylation of RuBP. Thus, CO₂ accumulates until carboxylation of RuBP plus CO₂ over-cycling to the MC balances MAL import. The model elegantly explains how a MC-BSC CO₂ gradient is sustained in terms of the e⁻/H⁺ constraints of ATP and NADPH production balanced to an overall ATP/NADPH utilization ratio of 2.56 (based on the hypothetical example of Supplemental Fig. S1) without the need for PSI cyclic photophosphorylation (Laisk et al., 2005). This contrasts with Takabayashi et al. (2005), who postulated a central role for NDH-dependent cyclic electron flow in the BSC. We point out that the latter model provided no mechanism for balancing the CO₂ fluxes in the MC-BSC system, leading to a concentration of CO₂ in the BSC. Furthermore, according to this model, a severe ATP deficit could occur in NDH-deficient leaves, leading to an A versus C_b relationship that does not overlap that observed in normal leaves, which is in contrast to results presented here (Fig. 9).

Finally, inability to form an active NDH supercomplex in maize does not completely abolish the capacity for concentration of CO₂ in the BSC. Under normal air conditions, the C_b/C_m ratios were still appreciable at approximately 4 and 5.5 for ZmNdho and ZmNdhn, respectively. Nor was PQ reduction activity in the dark diminished in the maize mutants to the extent observed in Arabidopsis mutants (Fig. 2). Although no mechanistic connection between these factors was established in this study, clearly redundancy in the CO₂ concentration system of the BSC is present that allows it to function independently of NDH, which may be homologous to the inducible pathways of PQ reduction revealed in C₃ plants. Furthermore, maize possesses significant levels of PEPCK (PEP carboxykinase; Koteyeva et al., 2015). Maize leaf PEPCK levels were higher than observed in the C₄ NADP-ME species Sorghum bicolor and numerous C₄ NAD-ME species but far lower than for the C₄ PEPCK species Spartina anglica. PEPCK was reportedly enriched in the BSC of maize and was responsible for Asp (ASP) decarboxylation to principally form PEP in bundle sheath strands (Wingler et al., 1999). Systems analysis of maize gene expression revealed ASP transport as a minor branch of the C₄ cycle between the MC and BSC (Pick et al., 2011). The latter authors discussed evidence for environmental or developmental metabolic flexibility in transport of MAL versus ASP, which could shift with patterns of N utilization and PGA reduction. Thus, it would be useful to compare global patterns of gene expression in normal and NDH-deficient maize as a preliminary test of metabolic flexibility. Likewise, it would be interesting to extend studies of NDH-deficiency to other C₄ types that harvest radiant energy differently.

MATERIALS AND METHODS

Plant Material

Zea mays seed lines containing putative nuclear NDH gene transposon insertions were obtained from the Maize Genetics Cooperative Stock Center (http://maizecoop.cropsci.uiuc.edu/). The lines were field-grown at Lockwood Farm (The CT Agricultural Experiment Station) in Hamden, CT during the summer of 2014 to genotype individual plants, obtain preliminary phenotypes, and collect progeny seed after selfing. Seed lines UFMu-02153 and AcDs-00112_I.S07.1657 were, respectively, found to segregate Mu7 and Ds transposon insertions into the ZmNDHO (GRMZM2G133844) and ZmNDHN (GRMZM2G110277) loci (Settles et al., 2007, Ahern et al., 2009). Progeny of these lines were studied in the laboratory. Maize was grown in a growth chamber on a 12 h/12 h light/dark 30°/20°C regime at a PFD of 500 μmol quanta m⁻² s⁻¹ provided by cool-white fluorescent and incandescent lamps (Peterson et al., 2014). Arabidopsis lines SALK_068922c (Columbia) and ET1999 (Landesberg) were obtained from The Arabidopsis Information Network (https://www.arabidopsis.org). These lines respectively carry a T-DNA insertion into NDHO and a Ds insertion into NDHN. Seedlings were grown on a long-day regime at an irradiance of 130 μmol quanta m⁻² s⁻¹ and 23°C (Peterson and Schultes 2014).

DNA Manipulations

Genomic DNA was extracted from maize seedlings using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Fragments corresponding to wild-type sequences were amplified using oligonucleotides NDHN1 (5′ CAATCAAGCGACTCCTCC 3′) and NDHN2 (5′ AAGAAACTAAAGGCGTGCTA 3′) yielding a 453 base-pair (bp) band or NDHOA (5′ AGAAGATCCTCAAGAAGAAGC 3′) and NDHOB (5′ ACTGGCATGTACGTATATACC 3′) yielding a 739-bp band from appropriate lines by PCR. Locus- and transposon-specific (Activator/Dissociator or Mutator) DNA fragments were amplified using oligonucleotides NDHN2 and DsSEQ2 (5′ ACACAACAGCTTGGTGCAAT 3′; Ahern et al., 2009) producing a band of approximately 1 kb or NDHOD (5′ CCCAAGCGATCTGAAATGCA 3′) and TIR8.4 (5′ CGCCTCCATTTCGTCGAATCACCTC 3′; Settles et al., 2007) to produce a 300-bp band, respectively. Genotypes were independently verified using primers NDHOC (5′ CTTCTCCCTCTAGCTCTCGC 3′) and NDHOD; with NDHOD and TIR6 (5′ AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC 3); or NDHN2 and JGp3 (5′ ACCCGACCGGATCGTATCGG 3′) and LC45 (5′ GTGCTGTACTGCTGTGACTTGTG 3′).

Gas Exchange and Optical Methods

Measurements were performed on recently expanded maize leaves at positions ranging from leaf 4 to 9 on plants ranging in age from 21 to 33 d after sowing. Mature rosette leaves of 23- to 30-d-old Arabidopsis plants were likewise employed. Details of the gas exchange and 810-nm absorbance systems (FAST-EST, Tartu, Estonia) and Chl fluorescence (H. Walz, Effeltrich, Germany) apparatus and procedures have been described in Peterson and Schultes (2014) and references therein. Leaf temperatures were 30°C for maize and 23°C for Arabidopsis. The water-jacketed leaf chamber maintained the leaf temperature within ±0.1°C. Dark respiration rate and pre-dawn minimal and maximal fluorescence yields (F  _od and F  _md) were recorded after ≥12 h of dark adaptation. Fluorescence signals (>700 nm) were corrected for photosystem I emission (Peterson et al., 2001). Gas concentrations are expressed as volume fractions (% or μl  l  ⁻¹) or equilibrium-dissolved aqueous phase molarities (μM). Responses of net CO₂ assimilation rate (A) and transpiration to changes in the external CO₂ level (C_o) for each maize leaf tested were sequentially assessed at 25, 15, 10, 5, 0, 45, 60, 100, 150, 200, 300, 400, 500, 600, and 700 μl CO₂  l  ⁻¹ in 21% O₂ (v/v, balance N₂) at an incident white light (400–700 nm) PFD of 750 or 1400 μmol quanta m⁻² s⁻¹. This sequence was repeated after lowering the O₂ level to 2% (v/v). Minimum (F_o), steady state (F_s), maximal (F_m), and variable (F_v = F_m – F_o) fluorescence yields were measured at each combination of CO₂ and O₂. Conductances to diffusion of CO₂ (expressed as dissolved liquid phase molarity, μM) across the stomatal [g_s = A/(C_o – C_m), mm s⁻¹] and mesophyll liquid phase plus enzymic (g_m = A/C_m at rate-limiting C_m, mm s⁻¹) barriers were assessed according to Laisk et al. (2002). Leaf absorbance of white light was measured on a 2.0-cm² disc from each test leaf using an integrating sphere.

Pigment Determinations

Individual leaves of Arabidopsis and maize leaf discs (2.0 cm²) were extracted by grinding in acetone. Pigments were quantified spectrophotometrically according to Lichtenthaler and Buschmann (2001).

Supplemental Data

The following supplemental materials are available.

• Supplemental Figure S1. A schematic of carbon and energy metabolism in the MC and BSC of maize according to the C₄ model of Laisk and Edwards (2000, 2009).

• Supplemental Figure S2. Photograph of normal and NDH-deficient maize seedlings.

ACKNOWLEDGMENTS

We thank Agu Laisk for helpful comments on the manuscript.

Glossary

 
• BSC

  bundle sheath cell

 
• CA

  complementary area

 
• ETR

  electron transport rate

 
• FRL

  far red light

 
• MC

  mesophyll cell

 
• PAD

  photosynthetic density

 
• PSI

  photosystem I

 
• PSII

  photosystem II

 
• WL

  white light

LITERATURE CITED

Author notes