-
PDF
- Split View
-
Views
-
Cite
Cite
Adam Hefel, Masayoshi Honda, Nicholas Cronin, Kailey Harrell, Pooja Patel, Maria Spies, Sarit Smolikove, Correction to ‘RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis’, Nucleic Acids Research, Volume 49, Issue 15, 7 September 2021, Page 9003, https://doi.org/10.1093/nar/gkab631
- Share Icon Share
The authors wish to introduce the following corrections to their article (1).
1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is:
TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACGTCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA
2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II.
The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.
REFERENCES
Author notes
The authors wish it to be known that, in their opinion, the second and third authors should be regarded as Joint Second Authors.
The authors wish it to be known that, in their opinion, the forth and fifth authors should be regarded as Joint Forth Authors.
Comments