Expression, DNA Binding Activity, and Transcriptional Activity of the Human Transcription Factor, CTF1/NFI, in Yeast A, Diagrams of the inserts used for expressing CTF1 and CTF1 derivatives in yeast, all under the control of the inducible yeast GAL1 promoter into the 2 μ plasmid, p2HG. The names of the plasmids are indicated above each diagram. Arrows show the orientation of transcription. The site of translation initiation, ATG, is positioned two nucleotides downstream from the NcoI site (N1 in p2HG-CTF1 and p2HG-CTFGAL4), respectively, nine nucleotides from the filled BamHI site (H1 in p2HG-VP16CTF1). In p2HG-CTFGAL4, the C-terminal proline-rich transcription activation domain of CTF1 was replaced by the acidic transcription activation domain of the yeast GAL4 protein. In p2HG-VP16CTF1, the acidic transcription activation domain of the viral VP16 protein was fused in frame to the N terminus of CTF1. p2HG-VP16CTF1 is a 2μ-based derivative of p2HG-VP16CTF1/hER from Fig. 4. Restriction enzyme sites used for the subcloning are indicated: B2, BglII; H1, BamHI; N1, NcoI; R1, EcoRI; S, SalI; X, XhoI. B, Reporter plasmid used for CTF1-dependent transcription activation analysis. One copy of a CTF/NF1 DNA-binding site was inserted into the XhoI site of pLGΔSmaI-XhoI as in Fig. 1. C, Bandshift assay to analyze the DNA-binding activity of CTF1 derivatives expressed in yeast. Cells transformed either with the expression plasmid, p2HG-CTF1 or p2HG-CTFGAL4, were grown as described in Fig. 2. Binding reactions were performed as described in Materials and Methods, using 50 μg protein extract each with 0.2 pmol specific DNA probe. A 32P-end-labeled oligomer, ds(CCTTTGGCATGCTGCCAATATG), containing one specific CTF/NFI DNA-binding site, was used as a specific DNA probe, and glucose (D) or galactose (G) were added as indicated. The arrow indicates the migration of the free probe. D, Transcriptional activity of CTF1 and CTF1-derivatives. β-Galactosidase activities were measured in extracts isolated from yeast cells transformed with p2HG-based CTF1 expression- and pLGCTF/NFI reporter plasmids. Cells were grown and the GAL1 promoter was induced by galactose as in panel C. Protein extracts were prepared and β-galactosidase activities were determined as described in Materials and Methods. The error bars indicate sd values from measurements of three independent transformants each. The fold stimulation of β-galactosidase activity is given with respect to the basal activity (2.5 ± 1.3) determined in the p2HG transformants.
