Table 2.
Open in new tab

Haplotypes analysis per population

PopulationNSNPCHRBP1 (HG19)BP2 (HG19)SNP1SNP2HAPLOTYPEFreqFreq casesFreq controlsORPHaplotype size (kb)
The Netherlands533188083987188137767rs76211316rs13319297CTGTGCGGATATTATGGCGGCA CCCTGTACGATCTGGCGCAT GTTCGCCTTAA0.380.35950.40.8460.0054953.7
Spain433188087628188122978rs9851967rs2049218TGCGGATATTATGGCGGCACCCT CGTACGATCTGGCGCATGTT0.4420.41840.48340.7680.00016835.3
Italy203188114458188122978rs12107245rs2049218CGTACCGATCTGGCGCATGT0.4530.42260.48940.7595.77E−078.5
UK113188116784188119901rs9820681rs2030519ACGATCTGGCG0.4470.40940.48180.7431.11E−383.1
Meta-analysisa143188116907188121019rs7634898rs12634152CCGATCTGGCGCAT0.4540.42190.48570.7711.35E−444.8
PopulationNSNPCHRBP1 (HG19)BP2 (HG19)SNP1SNP2HAPLOTYPEFreqFreq casesFreq controlsORPHaplotype size (kb)
The Netherlands533188083987188137767rs76211316rs13319297CTGTGCGGATATTATGGCGGCA CCCTGTACGATCTGGCGCAT GTTCGCCTTAA0.380.35950.40.8460.0054953.7
Spain433188087628188122978rs9851967rs2049218TGCGGATATTATGGCGGCACCCT CGTACGATCTGGCGCATGTT0.4420.41840.48340.7680.00016835.3
Italy203188114458188122978rs12107245rs2049218CGTACCGATCTGGCGCATGT0.4530.42260.48940.7595.77E−078.5
UK113188116784188119901rs9820681rs2030519ACGATCTGGCG0.4470.40940.48180.7431.11E−383.1
Meta-analysisa143188116907188121019rs7634898rs12634152CCGATCTGGCGCAT0.4540.42190.48570.7711.35E−444.8

NSNP is the number of SNPs per haplotype, position in base pair (BP) according with NCBI Build 37 Human Genome release 19 (HG19). SNP1 represents the SNP ID of the leftmost (5′) SNP and SNP2 is the SNP ID of rightmost (3′) SNP. In the HAPLOTYPE column, the alleles in the core haplotype are underlined. The minor allele from the top SNP rs2030519 from the meta-analysis is shown in bold. The ORs are shown for minor haplotypes. P-value (P) was calculated according to a haplotype logistic regression association test. Haplotype sizes are shown in kb.

aMeta-analysis without Indian and Polish cohorts.

Table 2.
Open in new tab

Haplotypes analysis per population

PopulationNSNPCHRBP1 (HG19)BP2 (HG19)SNP1SNP2HAPLOTYPEFreqFreq casesFreq controlsORPHaplotype size (kb)
The Netherlands533188083987188137767rs76211316rs13319297CTGTGCGGATATTATGGCGGCA CCCTGTACGATCTGGCGCAT GTTCGCCTTAA0.380.35950.40.8460.0054953.7
Spain433188087628188122978rs9851967rs2049218TGCGGATATTATGGCGGCACCCT CGTACGATCTGGCGCATGTT0.4420.41840.48340.7680.00016835.3
Italy203188114458188122978rs12107245rs2049218CGTACCGATCTGGCGCATGT0.4530.42260.48940.7595.77E−078.5
UK113188116784188119901rs9820681rs2030519ACGATCTGGCG0.4470.40940.48180.7431.11E−383.1
Meta-analysisa143188116907188121019rs7634898rs12634152CCGATCTGGCGCAT0.4540.42190.48570.7711.35E−444.8
PopulationNSNPCHRBP1 (HG19)BP2 (HG19)SNP1SNP2HAPLOTYPEFreqFreq casesFreq controlsORPHaplotype size (kb)
The Netherlands533188083987188137767rs76211316rs13319297CTGTGCGGATATTATGGCGGCA CCCTGTACGATCTGGCGCAT GTTCGCCTTAA0.380.35950.40.8460.0054953.7
Spain433188087628188122978rs9851967rs2049218TGCGGATATTATGGCGGCACCCT CGTACGATCTGGCGCATGTT0.4420.41840.48340.7680.00016835.3
Italy203188114458188122978rs12107245rs2049218CGTACCGATCTGGCGCATGT0.4530.42260.48940.7595.77E−078.5
UK113188116784188119901rs9820681rs2030519ACGATCTGGCG0.4470.40940.48180.7431.11E−383.1
Meta-analysisa143188116907188121019rs7634898rs12634152CCGATCTGGCGCAT0.4540.42190.48570.7711.35E−444.8

NSNP is the number of SNPs per haplotype, position in base pair (BP) according with NCBI Build 37 Human Genome release 19 (HG19). SNP1 represents the SNP ID of the leftmost (5′) SNP and SNP2 is the SNP ID of rightmost (3′) SNP. In the HAPLOTYPE column, the alleles in the core haplotype are underlined. The minor allele from the top SNP rs2030519 from the meta-analysis is shown in bold. The ORs are shown for minor haplotypes. P-value (P) was calculated according to a haplotype logistic regression association test. Haplotype sizes are shown in kb.

aMeta-analysis without Indian and Polish cohorts.

Close
This Feature Is Available To Subscribers Only

Sign In or Create an Account

Close

This PDF is available to Subscribers Only

View Article Abstract & Purchase Options

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Close