-
PDF
- Split View
-
Views
-
Cite
Cite
Zhaoyue Wang, Xuejing Bai, Xiuping He, Borun Zhang, Secretion expression of SOD1 and its overlapping function with GSH in brewing yeast strain for better flavor and anti-aging ability, Journal of Industrial Microbiology and Biotechnology, Volume 41, Issue 9, 1 September 2014, Pages 1415–1424, https://doi.org/10.1007/s10295-014-1481-9
- Share Icon Share
Abstract
Superoxide dismutase (SOD) is a significant antioxidant, but unlike glutathione (GSH), SOD cannot be secreted into beer by yeast cells during fermentation, this directly leads to the limited application of SOD in beer anti-aging. In this investigation, we constructed the SOD1 secretion cassette in which strong promoter PGK1p and the sequence of secreting signal factor from Saccharomyces cerevisiae were both harbored to the upstream of coding sequence of SOD1 gene, as a result, the obtained strains carrying this cassette successfully realized the secretion of SOD1. In order to overcome the limitation of previous genetic modification on yeast strains, one new comprehensive strategy was adopted targeting the suitable homologous sites by gene deletion and SOD1 + GSH1 co-overexpression, and the new strain ST31 (Δadh2::SOD1 + Δilv2::GSH1) was constructed. The results of the pilot-scale fermentation showed that the diacetyl content of ST31 was lower by 42 % than that of the host, and the acetaldehyde content decreased by 29 %, the GSH content in the fermenting liquor of ST31 increased by 29 % compared with the host. Both SOD activity test and the positive and negative staining assay after native PAGE indicated that the secreted active SOD in the fermenting liquor of ST31 was mainly a dimer with the size of 32,500 Da. The anti-aging indexes such as the thiobarbituric acid and the resistance staling value further proved that the flavor stability of the beer brewed with strain ST31 was not only better than that of the original strain, but also better than that of the previous engineering strains. The multi-modification and comprehensive improvement of the beer yeast strain would greatly enhance beer quality than ever, and the self-cloning strain would be attractive to the public due to its bio-safety.
Introduction
Flavor stability is an important index for alcoholic beverage such as wine and beer, and flavor components have a significant effect on their quality [33]. However, oxidation which can produce off-flavor components such as aldehyde often occurs during beer storage. As a product brewed with various ingredients, beer has different antioxidant components, for example: ferulic acid and polyphenol derived from malt and hops; SO2 and glutathione (GSH), small molecules secreted by yeast, and so on. Based on yeast strain profile, several researches in relationship to beer flavor stability have been studied, and both SO2 and GSH were reported to be important antioxidants responsible for the antioxidant activity of lager beer [41, 47]. SO2 is produced by yeast during reductive sulfate assimilation [47]. Mutants which can produce higher levels of SO2 have been obtained by over-expression of SSU1 and/or MET14 [5] or by disruption of MET10 [14]. However, these yeasts were obtained from heterologous recombinant DNA such as antibiotics gene which cannot be applied commercially. In addition, although breeding of Saccharomyces strains which produce high levels of SO2 is relative effective, it is accompanied by the undesirable H2S produced as an intermediate in this pathway. Compared with SO2, antioxidant GSH is more important to beer flavor. Since GSH also plays significant role in protein synthesis, DNA synthesis and amino acid transportation [6, 24], increase of GSH expression is helpful to improve the performance of both yeast cells and beer. GSH is synthesized by two sequential reactions in Saccharomyces cerevisiae, and GSH1 gene encodes for γ-glutamylcysteine synthetase (EC 6.3.2.2) catalyzing the rate-limiting reaction during GSH synthesis [22]. Cloning of GSH1 gene and its over-expression in S. cerevisiae have been reported by some researchers [8, 46], and the content of GSH in the beer fermented with these transformants increased, however, most of these transformants were hazardous for application in the beer industry because exogenous DNA such as bacteria gene has been carried into the host cells. In recent years, we have constructed several self-cloning strains with GSH1 gene over-expression and some other genes’ deletion [38–41] through self-cloning technique; as a result, the antioxidability of the beer brewed with these strains were improved. During the self-cloning genetic operation, all the knocked-in and knocked-out genes are from beer yeast strain, and the engineering strains harbored no heterologous DNA; therefore, the strains modified by self-cloning technique are considered to be secure and easily accepted by public [1]. In spite of the advantage of the self-cloning strains, in our previous studies, the increased content of GSH was not high enough, one reason might be that we only expressed one more copy of GSH in the transformants; hence, more investigations are necessary for improving yeast strains further. In order to increase the content of antioxidants, expression more copies of genes for GSH or other antioxidant such as SOD might be available.
Superoxide dismutase (SOD) is a kind of enzymatic antioxidant; it is significant just like nonenzymatic antioxidant glutathione GSH. SOD is regarded as a fundamental defense agent against reactive oxygen species [4, 16, 30, 31]. There are two forms of SOD identified in S. cerevisiae, one is copper-and-zinc-containing SOD (CuZnSOD or SOD1) and the other is manganese-containing SOD (MnSOD or SOD2) [23]. SOD1 locates mainly in the cytosol and is also found in the mitochondrial intermembrane space [32], accounting for 90–95 % of the total superoxide dismutase activity [42]. Both superoxide dismutase and glutathione are abundant and ubiquitous, and previous work also found that glutathione and SOD provided overlapping defensive function [11, 20]; however, SOD can hardly contribute antioxidability to beer because it localizes in yeast cells and cannot enter into beer spontaneously. We constructed the engineering yeast strain and made SOD secrete into beer [21]; regretfully, the vitality of the strain was not stable, so a new strategy had to be considered.
In addition to the role of antioxidants, beer flavor stability also depends on some crucial flavor components such as diacetyl and acetaldehyde. Diacetyl is an intermediate compound during the biosynthesis of isoleucine–valine in yeast. Many methods have been adopted for decreasing the diacetyl content during the production of beer, including improvement of fermentation process and genetic modification of yeast strain. For example, expression of heterologous gene like α-acetolactate decarboxylase gene in yeast [2, 29, 44]; or over-expression or deletion of homologous genes just like ILV2, ILV3 and ILV5 could result in the decrease of diacetyl content in beer [19, 34, 35]. Acetaldehyde is an intermediate in ethanol biosynthetic pathway of yeast. As the acetaldehyde content in Chinese beer is usually higher (3–8 mg/L) than in overseas fine beer (<2 mg/L) [36], researchers have paid more attention on acetaldehyde metabolism of yeast in order to control the acetaldehyde content in beer. Several genes in S. cerevisiae are related to acetaldehyde synthesis, such as pyruvate decarboxylase gene, aldehyde dehydrogenase gene and alcohol dehydrogenase gene (ADH); of these, the ADH2 gene is considered as an important gene for regulating the acetaldehyde content in beer because alcohol dehydrogenase II (YADH-2) encoded by ADH2 catalyzes ethanol into acetaldehyde [25], which has less effect on the metabolic balance in yeast cells. Some genetic engineering yeast strains with low content of diacetyl or acetaldehyde have been constructed, but they are potentially dangerous for industrial application due to the existence of bacteria gene [13, 17, 36]; while other engineering strains can only be used in laboratory because of their auxotrophic or haploid characteristics ([28], Saccharomyces Genome Deletion Project web page). Several self-cloning strains with low content of diacetyl or acetaldehyde have ever been constructed in our laboratory, however, only one gene was deleted in the previous recombined strains [39–41], and the beer flavor was not improved comprehensively. Hence, further and extensive modification is necessary, for example, co-deletion of both ILV2 and ADH2 gene which are responsible for off-flavor components might be helpful to improve the strain greatly. In addition, ILV6 deletion has been reported to reduce diacetyl in some lager beer yeast [7]; this extends the field for diacetyl regulation and may be suitable for other yeast strains’ modification.
In order to make full use of the better effect of oxidation resistance offered by overlapping function of the antioxidants, new and comprehensive strategy was designed in this study. We adopted the strategy of multi-gene regulation in one industrial yeast strain, for example, SOD1 with secretion ability and GSH were both over-expressed, at the same time both ILV2 and ADH2 gene were deleted in the same yeast strain. In order to avoid the shortcoming that emerged in our previous strains such as the unstable vitality, the suitability between modified genes was considered and a different locus for SOD1 insertion was adopted in the new design. Consequently, the performance of the new constructed strain improved, and the flavor and anti-aging property of the beer brewed with the modified strain were enforced greatly; this kind of beer yeast strain was not reported by other researchers by now.
Materials and methods
Strains, plasmids and cultivation conditions
The strains and plasmids used in this study are listed in Table 1. Escherichia coli DH5α was used as the host for plasmid construction. Industrial brewer’s yeast strain QY31 was provided by Tsingtao Beer Company (Qingdao, China).
Strains and plasmids used in this study
Strains or plasmids . | Relevant genotype . | Reference or source . |
---|---|---|
Strains | ||
E.coli. DH5α | supE44 ΔlacU169(φ80lacZΔM15) hsdR17 recAl endAl gyrA96 thi-1 relAl | Stratagene |
QY31 | Wild-type yeast strain | Tsingtao Beer Company (Qingdao, China) |
T31-2 | Recombined strain (Δilv2: :GSH1) | [40] |
S31 | Recombined strain (Δadh2: : SOD1) | This work |
ST31 | Recombined strain (Δadh2::SOD1 + Δilv2: :GSH1) | This work |
Plasmids | ||
pPIC9 | Cloning vector, amp | Invitrogen |
pMP1 | Cloning vector, amp | [49] |
pYCUP | Recombined plasmid, URA3 amp | [48] |
pADH | Recombined plasmid, URA3 amp | [41] |
pMPS1 | Recombined plasmid, amp | This work |
pAS1C | Recombined plasmid, URA3 amp | This work |
Strains or plasmids . | Relevant genotype . | Reference or source . |
---|---|---|
Strains | ||
E.coli. DH5α | supE44 ΔlacU169(φ80lacZΔM15) hsdR17 recAl endAl gyrA96 thi-1 relAl | Stratagene |
QY31 | Wild-type yeast strain | Tsingtao Beer Company (Qingdao, China) |
T31-2 | Recombined strain (Δilv2: :GSH1) | [40] |
S31 | Recombined strain (Δadh2: : SOD1) | This work |
ST31 | Recombined strain (Δadh2::SOD1 + Δilv2: :GSH1) | This work |
Plasmids | ||
pPIC9 | Cloning vector, amp | Invitrogen |
pMP1 | Cloning vector, amp | [49] |
pYCUP | Recombined plasmid, URA3 amp | [48] |
pADH | Recombined plasmid, URA3 amp | [41] |
pMPS1 | Recombined plasmid, amp | This work |
pAS1C | Recombined plasmid, URA3 amp | This work |
Strains and plasmids used in this study
Strains or plasmids . | Relevant genotype . | Reference or source . |
---|---|---|
Strains | ||
E.coli. DH5α | supE44 ΔlacU169(φ80lacZΔM15) hsdR17 recAl endAl gyrA96 thi-1 relAl | Stratagene |
QY31 | Wild-type yeast strain | Tsingtao Beer Company (Qingdao, China) |
T31-2 | Recombined strain (Δilv2: :GSH1) | [40] |
S31 | Recombined strain (Δadh2: : SOD1) | This work |
ST31 | Recombined strain (Δadh2::SOD1 + Δilv2: :GSH1) | This work |
Plasmids | ||
pPIC9 | Cloning vector, amp | Invitrogen |
pMP1 | Cloning vector, amp | [49] |
pYCUP | Recombined plasmid, URA3 amp | [48] |
pADH | Recombined plasmid, URA3 amp | [41] |
pMPS1 | Recombined plasmid, amp | This work |
pAS1C | Recombined plasmid, URA3 amp | This work |
Strains or plasmids . | Relevant genotype . | Reference or source . |
---|---|---|
Strains | ||
E.coli. DH5α | supE44 ΔlacU169(φ80lacZΔM15) hsdR17 recAl endAl gyrA96 thi-1 relAl | Stratagene |
QY31 | Wild-type yeast strain | Tsingtao Beer Company (Qingdao, China) |
T31-2 | Recombined strain (Δilv2: :GSH1) | [40] |
S31 | Recombined strain (Δadh2: : SOD1) | This work |
ST31 | Recombined strain (Δadh2::SOD1 + Δilv2: :GSH1) | This work |
Plasmids | ||
pPIC9 | Cloning vector, amp | Invitrogen |
pMP1 | Cloning vector, amp | [49] |
pYCUP | Recombined plasmid, URA3 amp | [48] |
pADH | Recombined plasmid, URA3 amp | [41] |
pMPS1 | Recombined plasmid, amp | This work |
pAS1C | Recombined plasmid, URA3 amp | This work |
E. coli strain was grown at 37 °C in Luria–Bertani medium [26] supplemented with ampicillin (100 mg/L) when necessary. The yeast strain for transformation was grown at 28 °C in YEPD medium (1 % yeast extract, 2 % peptone and 2 % glucose). YEPD or 12°P wort was used as the medium for culture or fermentation of the yeast strains.
DNA manipulation, analysis and construction of plasmids
The primers used in this study are listed in Table 2. Genomic DNA of yeast strains was prepared as described by Burke et al. [3]. Plasmid DNA was prepared from E. coli as described by Sambrook and Russell [26].
Oligonucleotide primers used in PCR amplification
Primers . | Sequence 5΄ → 3΄ . |
---|---|
α-L | CCAGAATTCCCAAACGATGAGATTTCCTTC (EcoRI) |
α-R | CGATCTAGATACGTAAGCTTCAGCCTC (XbaI) |
SOD1-L | CACTCTAGAATGGTTCAAGCAGTCGCAG (XbaI) |
SOD1-R | CTAGAGCTCGGACCCCTCAAGACCCCTC (SacI) |
CUP1-L | CGCTATACGTGCATATGTTC |
CUP1-R | ATCTGTTGTACTATCCGCTT |
ADH2-L | GCTGTTATGTTCAAGGTC |
ADH2-R | TTCAGAGGAGCAGGACAA |
Primers . | Sequence 5΄ → 3΄ . |
---|---|
α-L | CCAGAATTCCCAAACGATGAGATTTCCTTC (EcoRI) |
α-R | CGATCTAGATACGTAAGCTTCAGCCTC (XbaI) |
SOD1-L | CACTCTAGAATGGTTCAAGCAGTCGCAG (XbaI) |
SOD1-R | CTAGAGCTCGGACCCCTCAAGACCCCTC (SacI) |
CUP1-L | CGCTATACGTGCATATGTTC |
CUP1-R | ATCTGTTGTACTATCCGCTT |
ADH2-L | GCTGTTATGTTCAAGGTC |
ADH2-R | TTCAGAGGAGCAGGACAA |
All the primers are designed according to the sequence of model strain Saccharomyces cerevisiae. The sequences of restriction enzyme’s site (underlined) and the protective bases are added to the upstream of those primers which are used in plasmid construction
Oligonucleotide primers used in PCR amplification
Primers . | Sequence 5΄ → 3΄ . |
---|---|
α-L | CCAGAATTCCCAAACGATGAGATTTCCTTC (EcoRI) |
α-R | CGATCTAGATACGTAAGCTTCAGCCTC (XbaI) |
SOD1-L | CACTCTAGAATGGTTCAAGCAGTCGCAG (XbaI) |
SOD1-R | CTAGAGCTCGGACCCCTCAAGACCCCTC (SacI) |
CUP1-L | CGCTATACGTGCATATGTTC |
CUP1-R | ATCTGTTGTACTATCCGCTT |
ADH2-L | GCTGTTATGTTCAAGGTC |
ADH2-R | TTCAGAGGAGCAGGACAA |
Primers . | Sequence 5΄ → 3΄ . |
---|---|
α-L | CCAGAATTCCCAAACGATGAGATTTCCTTC (EcoRI) |
α-R | CGATCTAGATACGTAAGCTTCAGCCTC (XbaI) |
SOD1-L | CACTCTAGAATGGTTCAAGCAGTCGCAG (XbaI) |
SOD1-R | CTAGAGCTCGGACCCCTCAAGACCCCTC (SacI) |
CUP1-L | CGCTATACGTGCATATGTTC |
CUP1-R | ATCTGTTGTACTATCCGCTT |
ADH2-L | GCTGTTATGTTCAAGGTC |
ADH2-R | TTCAGAGGAGCAGGACAA |
All the primers are designed according to the sequence of model strain Saccharomyces cerevisiae. The sequences of restriction enzyme’s site (underlined) and the protective bases are added to the upstream of those primers which are used in plasmid construction
Copper-and-zinc-containing superoxide dismutase gene, SOD1, was amplified from the genomic DNA of QY31 with primers SOD1-L/SOD1-R using PCR. Alpha factor leader sequence was amplified from cloning vector pPIC9 (Invitrogen) with primers α-L/α-R using PCR. PCR for amplification of these DNA fragments was performed in 50 μL volume with 25 μL 2× Pfu PCR MasterMix, 400 ng of template DNA and 0.4 μM primers. Cycle conditions were 94 °C for 5 min followed by 30 cycles of 94 °C for 40 s, 55 °C for 1 min, 72 °C for 2 min and finally 72 °C for 15 min.

Map of plasmid pMPS1. Main elements of pMPS1: PGK1p promoter, α-factor, SOD1

Map of plasmid pAS1C. Main elements of pAS1C: part of ADH2 sequence as the left and right arms for homologous recombination (ADH2-L, ADH2-R), PGK1p promoter + α-factor + SOD1, CUP1 gene as marker for screening
DNA fragments for recombination was amplified from plasmid pAS1C with primers ADH2-L/ADH2-R using PCR, which was carried out in 100 μL volume with 50 μL 2× Long Taq PCR MasterMix, 800 ng of template DNA and 0.4 μM primers. PCR analysis of yeast recombinants was carried out in 10 μL volume with 5 μL 2× Long Taq PCR MasterMix, 160 ng of template DNA and 0.4 μM primers. Cycle conditions were 94 °C for 5 min followed by 30 cycles of 94 °C for 40 s, 55 °C for 1 min, 72 °C for 4 min and finally 72 °C for 15 min.
The sequence of the constructed plasmids and PCR fragments of recombinants genomic DNA were analyzed using automated DNA sequencer.
Transformation and screening of yeast strains
The DNA fragments prepared by PCR for yeast transformation were purified according to the DNA Gel Extraction Kit, and used for yeast recombination using the lithium acetate method as described [15, 27]. The recombined strains were selected on YEPD plate with copper sulfate (CuSO4).
Analysis of enzyme activity and genetic stability
The recombined strains and their host were cultivated in 50 mL YEPD at 28 °C for 2 days, and the yeast cells and fermenting liquor were then used for preliminary assay including enzyme activity of alcohol dehydrogenase II (YADH-2) and superoxide dismutase (SOD). SOD activity was assayed as described by Xie et al. [43]; YADH-2 activity was measured as described by Wang et al. [41].
Yeast recombinants for stability analysis were successively transferred into YEPD medium for 50 generations, and the 50th generation strains were used for copper-resistance stability by plate streaking and also for identification of genome DNA by PCR as described by Wang et al. [41]. YADH-2 and SOD enzyme activity of the 50th generation strains were also detected.
Fermentation and analysis of metabolites
The host and recombinants were first grown in 5 mL of 12° P wort at 25 °C for 30 h, then they were, respectively, inoculated into 60 mL of wort (12°P) at a ratio of 1:50. After cultivation at 25 °C for 60 h, these strains were inoculated into 480 mL of 12° P wort in 1-L triangle bottles and fermented at 10 °C for 16 days. Samples were assayed every day.
The initial activation and propagation for the pilot-scale brewing was performed similarly to the above and the conical flasks with fermentation bungs was firstly used for fermentation at 10 °C for 10 days. During the fermentation, the flasks were weighed every day, and the difference of the flasks in weight on two adjacent days during fermentation was the CO2 reduction. The yeast pellets centrifuged from the conical flasks after fermentation were inoculated into a 6-L European Brewery Convention (EBC) tube with 5 L 12° P wort and fermented at 10 °C for 12 days.
SOD activity in the fermented liquor was detected as described by Xie et al. [43] and was also assayed using positive and negative staining methods after polyacrylamide gel electrophoresis (PAGE) [45]. GSH content was measured as described by Wang et al. [41].
Attenuation degree and real extract concentration in the filtrate of the fermenting liquor were measured using Beer Analyzer. Acetaldehyde and diacetyl content were measured using gas chromatography. GSH content was determined using 5, 5′-dithiobis (2-nitrobenzoic acid) (DTNB) method [8]. The thiobarbituric acid (TBA) value was measured as described by Grigsby and Palamand [12]. The flavor freshness period was assessed using the resistance staling value (RSV): RSV = 1/4 (12/∆TBA12 + 24/∆TBA24 + 36/∆TBA36 + 48/∆TBA48). ∆TBA12–48 is the difference in TBA between the control that is kept at 0 °C and the samples that were kept at 60 °C for 12, 24, 36 and 48 h, respectively, before TBA measurement.
Results
Construction of plasmids, selection of transformants and enzyme activity assay

DNA cassettes in self-cloning strains. Strain S31: Δadh2::SOD1+CUP1. Strain T31-2: Δilv2::GSH1+CUP1. Strain ST31: Δadh2::SOD1+CUP1, Δilv2::GSH1
PCR verification, sequence analysis and genetic stability

PCR analysis of transformant and host genome. Genome DNA templates: 1–4 host QY31; 5–8 ST31. Primers: 1, 5 SOD1-L/ADH2-L; 2, 6 α-R/CUP1-R; 3, 7 CUP1-L/ADH2-R; 4, 8 ADH2-L/ADH2-R. M marker. The results of strain S31 is the same as that of ST31 (not shown)
The PCR products using ADH2-L/ADH2-R as primer pair and transformants genome as template were also tested by sequence analysis, the results displayed identity to reported sequences as theoretical anticipation, and further proved that ADH2 gene was successfully knocked out by PGK1p + α-factor + SOD1 + CUP1 knock-in in strain S31 and ST31.
Both S31 and ST31 strains were analyzed for their stability. Copper-resistance stability was detected by observing the growth of randomly selected 50 single-grown colonies of the 50th generation recombinants on YEPD with 7.5 and 9.5 mM CuSO4, respectively, and the results of increased resistance suggested that the over-expression of the inserted CUP1 gene was genetically stable. The results of PCR verification for genome DNA of the 50th generation of the recombinants S31 and ST31 were consistent with that of the first generation, which further indicated the genetic stability of ADH2 deletion and integration of SOD1 and CUP1 in these recombined strains. The results of enzyme activity of SOD and YADH-2 of the 50th generation recombinants were consistent with that of the first generation, this also illustrated that these constructed strains were genetically stable.
Fermentation test in triangle bottles

Parameters’ comparison during triangle bottle fermentation of transformants and the host. a–f are, respectively, the results of the content of diacetyl, acetoin, acetaldehyde, GSH, the thiobarbituric acid (TBA) and SOD activity of transformants and the host
Compared with the wild-type host strain QY31 and the engineering strain S31 and T31-2 with only one gene deletion and one gene over-expression, the multi genes modified strain ST31 presented advantageous performance comprehensively during the fermentation in triangle bottles; hence, ST31 was chosen for further fermentation test.
Pilot-scale brewing
The fermentation ability of the newly constructed strain ST31 was not affected by the genetic modification according to the results as follow. Firstly, CO2 reduction of recombinant ST31 during conical flask fermentation for the pilot-scale brewing was analogous to that of the host; secondly, the assay of attenuation further confirmed that ST31 presented a similar degree of fermentation compared with the host (Table 3). Both of the above results indicated that integration of SOD1 and GSH1 into the internal of ADH2 and ILV2 in our yeast strains did not change their fermentation performance.
Performance parameters in pilot-scale brewing
Parameters . | In conical flasks . | In EBC tube . | ||
---|---|---|---|---|
QY31 . | ST31 . | QY31 . | ST31 . | |
Real attenuation (%) | 66.95 ± 0.05 | 67.23 ± 0.04 | 67.05 ± 0.04 | 67.23 ± 0.05 |
Real extract (%) | 4.44 ± 0.02 | 4.39 ± 0.02 | 4.26 ± 0.03 | 4.39 ± 0.03 |
Diacetyl (μg/L) | 222 ± 5 | 122 ± 4 | 191 ± 3 | 111 ± 3 |
Acetaldehyde (mg/L) | 10.75 ± 0.5 | 7.53 ± 0.4 | 9.95 ± 0.5 | 7.02 ± 0.3 |
GSH (mg/L) | 7.41 ± 0.8 | 9.55 ± 0.6 | 7.55 ± 0.5 | 9.72 ± 0.8 |
SOD (U/ml) | – | 66 ± 3 | – | 60 ± 4 |
TBA (OD530) | – | – | 0.63 ± 0.04 | 0.51 ± 0.03 |
RSV | – | – | 415 ± 6 | 522 ± 5 |
Parameters . | In conical flasks . | In EBC tube . | ||
---|---|---|---|---|
QY31 . | ST31 . | QY31 . | ST31 . | |
Real attenuation (%) | 66.95 ± 0.05 | 67.23 ± 0.04 | 67.05 ± 0.04 | 67.23 ± 0.05 |
Real extract (%) | 4.44 ± 0.02 | 4.39 ± 0.02 | 4.26 ± 0.03 | 4.39 ± 0.03 |
Diacetyl (μg/L) | 222 ± 5 | 122 ± 4 | 191 ± 3 | 111 ± 3 |
Acetaldehyde (mg/L) | 10.75 ± 0.5 | 7.53 ± 0.4 | 9.95 ± 0.5 | 7.02 ± 0.3 |
GSH (mg/L) | 7.41 ± 0.8 | 9.55 ± 0.6 | 7.55 ± 0.5 | 9.72 ± 0.8 |
SOD (U/ml) | – | 66 ± 3 | – | 60 ± 4 |
TBA (OD530) | – | – | 0.63 ± 0.04 | 0.51 ± 0.03 |
RSV | – | – | 415 ± 6 | 522 ± 5 |
TBA the thiobarbituric acid, RSV the resistance staling
Performance parameters in pilot-scale brewing
Parameters . | In conical flasks . | In EBC tube . | ||
---|---|---|---|---|
QY31 . | ST31 . | QY31 . | ST31 . | |
Real attenuation (%) | 66.95 ± 0.05 | 67.23 ± 0.04 | 67.05 ± 0.04 | 67.23 ± 0.05 |
Real extract (%) | 4.44 ± 0.02 | 4.39 ± 0.02 | 4.26 ± 0.03 | 4.39 ± 0.03 |
Diacetyl (μg/L) | 222 ± 5 | 122 ± 4 | 191 ± 3 | 111 ± 3 |
Acetaldehyde (mg/L) | 10.75 ± 0.5 | 7.53 ± 0.4 | 9.95 ± 0.5 | 7.02 ± 0.3 |
GSH (mg/L) | 7.41 ± 0.8 | 9.55 ± 0.6 | 7.55 ± 0.5 | 9.72 ± 0.8 |
SOD (U/ml) | – | 66 ± 3 | – | 60 ± 4 |
TBA (OD530) | – | – | 0.63 ± 0.04 | 0.51 ± 0.03 |
RSV | – | – | 415 ± 6 | 522 ± 5 |
Parameters . | In conical flasks . | In EBC tube . | ||
---|---|---|---|---|
QY31 . | ST31 . | QY31 . | ST31 . | |
Real attenuation (%) | 66.95 ± 0.05 | 67.23 ± 0.04 | 67.05 ± 0.04 | 67.23 ± 0.05 |
Real extract (%) | 4.44 ± 0.02 | 4.39 ± 0.02 | 4.26 ± 0.03 | 4.39 ± 0.03 |
Diacetyl (μg/L) | 222 ± 5 | 122 ± 4 | 191 ± 3 | 111 ± 3 |
Acetaldehyde (mg/L) | 10.75 ± 0.5 | 7.53 ± 0.4 | 9.95 ± 0.5 | 7.02 ± 0.3 |
GSH (mg/L) | 7.41 ± 0.8 | 9.55 ± 0.6 | 7.55 ± 0.5 | 9.72 ± 0.8 |
SOD (U/ml) | – | 66 ± 3 | – | 60 ± 4 |
TBA (OD530) | – | – | 0.63 ± 0.04 | 0.51 ± 0.03 |
RSV | – | – | 415 ± 6 | 522 ± 5 |
TBA the thiobarbituric acid, RSV the resistance staling
After conical flask fermentation, the diacetyl content in the fermenting liquor of ST31 decreased by 45 % compared with that of the host. The acetaldehyde content of ST31 was 30 % lower than that of the host. In comparison with the host, the GSH content in the fermenting liquor of ST31 increased by 29 %, and the SOD activity also presented in the fermenting liquor of ST31 (Table 3).
After EBC tube fermentation, real attenuation and real extract of the recombinants were similar to that of the host, the diacetyl content of ST31 decreased by 42 %, and the acetaldehyde content was lower by 29 % compared with that of the host (Table 3). The difference of GSH content in fermenting liquor from the EBC tube between the host and ST31 is similar to that of previous conical flasks process, and so did SOD activity.

SOD1 activity of ST31 assayed by positive and negative staining methods. Positive staining: 1, 2; negative staining: 3, 4. Strains: 1, 3 host; 2, 4 ST31
In terms of the results shown in Table 3, the decreased TBA value of the ST31 reflected that the antioxidant capacity of fermenting liquor from ST31 was increased. The increased RSV value of ST31 (Table 3) provided further evidence that the flavor freshness performance of ST31 was better than that of the host.
Discussion
Beer that is particularly high in antioxidants may have more stable sensory characteristics, such as better flavor and aroma, which should result in higher quality and longer shelf life. There are several different compounds in beer contributing to anti-aging effect. Besides that some components from malt and hops may partly play the role in promoting the antioxidant activity in beer, GSH from yeast also can offer antioxidant capacity for beer.
GSH is not only a significant antioxidant against the toxic effects of O2 and other oxidative compounds, it also plays an important role in DNA synthesis, protein synthesis and post-translational modification [10, 24]. As a smaller molecular, GSH in yeast cells can release into the fermenting liquor automatically. Both the multi-functions of GSH and its easy accessibility to the beer make it more important in improving beer anti-aging ability; this has been proved by our previously work. However, this improvement is relatively limited. One reason might be that the added copy of GSH1 gene was less; another reason might be that much of the over-expressed GSH might stay in the yeast cells, and only a small quantity of GSH is secreted into the fermenting liquor, which were not effective enough for better anti-aging ability. Hence, further extensive strategies or other antioxidant modifications are necessary.
Similar to GSH, SOD is not only a fundamental antioxidant, it is also an important element of a protein network that ensures proper functions of mitochondria [18]; but unlike GSH, SOD cannot secrete from yeast cells into the beer freely, therefore secretion strategy should be considered if we want to increase the antioxidability of beer by over-expression SOD.
In order to make SOD play its antioxidant role in beer, we constructed the engineering yeast strain which realized SOD secretion into beer by interrupting ILV2 at the same time. Unfortunately, the recombined strain only gave better anti-aging ability during the earlier experimental period, and we found that the strain had no vitality stability later. The reason for this phenomenon was still unclear; one surmise may be the unsuitability between SOD1 and the interrupted ILV2. Considering the complexity of interaction of different genes or DNA fragment, new comprehensive strategy was adopted in this investigation. In order to avoid the negative role of SOD1 expression with ILV2 deletion on yeast cells growth, we inserted SOD1 to the locus of internal of ADH2 gene in this study. Since Swiegers et al. [33] has reported that when the strong promoter such as promoter of 3-phosphoglycerate kinase of S. cerevisiae (PGK1p) was used to construct engineering wine yeast strain, wine flavor could be improved, we also adopted PGK1p to enhance SOD1 expression in this study. In the meantime, we inserted signal DNA element of S. cerevisiae to the upstream of coding sequence SOD1 gene for SOD1 secretion. The new strategy was successful, and we surmised that the locus of ADH2 gene is suitable for SOD1 insertion.
Besides a little of improvement on anti-aging ability in our previous engineering strains, another shortcoming is that the main flavor indexes such as diacetyl and acetaldehyde were not improved at the same strain. The strategy of double genes’ deletion and over-expression should probably make the flavor and the antioxidability of the beer better because the content of crucial off-flavor components would decrease and the content of two kinds of antioxidants increased. In addition, the overlapping function of SOD1 and GSH would offer the beer more antioxidant ability. As we anticipated, the constructed strains with both ADH2 and ILV2 disruption and over-expression of GSH1and SOD1 had good performance, which is reflected in Fig. 5a–f and Table 3. No matter whether the fermentation is in triangle bottles or in pilot scale, SOD1+GSH co-overexpression resulted in the better effect of oxidation resistance than respective function of SOD1 and GSH.
In summary, the performance of the beer yeast strain was greatly improved by over-expression of SOD1 + GSH and by decrease of off-flavor components such as diacetyl and acetaldehyde simultaneously. The comprehensive modification in strain ST31(Δadh2::SOD1 + Δilv2::GSH1) not only provided a better flavor for the beer, but also made beer flavor more stable due to the co-effect of SOD1 and GSH. All the improved performance will be helpful to enhance beer quality greatly and be attractive to consumer, which will probably bring more profits for the beer industry. On the other hand, no heterologous DNA was brought into the brewing yeast strain during all the genetic modification; hence, the bio-safety of the engineering strain is fine.
Both flavor and antioxidant capacity are important to alcoholic beverage, and the development of biotechnology and exploitation of yeast metabolic mechanism have extended regulation of industrial strains in many ways. Besides the modification of ILV2, ADH2, GSH1 and SOD1 manipulated in our study, some other genes and global factors affecting beer or wine yeast strain have been reported such as ILV6, SOD2, HSP12, etc. [7, 9]; inhibitor of alcohol dehydrogenases (ADH) such as 4-methylpyrazole was also reported to be used in beer flavor regulation [37]. All these investigations will be very helpful to more full modification of yeast strain in later research; as a result, a diversity of beer or wine with better quality will be produced in the future.
Acknowledgments
Many thanks to all the members at the Microbiology Laboratory and the engineers at the Test Laboratory of Research and Development Center in Tsingtao Brewery Co., Ltd., for providing us the kind help on pilot-scale fermentation and tests of fermentation parameters.
References
Burke D, Dawson D, Stearns T (2000) Yeast DNA isolations. In: Methods in yeast genetics. A cold spring harbor laboratory course manual. pp 109–111