A Highly Attenuated Panfilovirus VesiculoVax Vaccine Rapidly Protects Nonhuman Primates Against Marburg Virus and 3 Species of Ebola Virus

Abstract

Background

The family Filoviridae consists of several virus members known to cause significant mortality and disease in humans. Among these, Ebola virus (EBOV), Marburg virus (MARV), Sudan virus (SUDV), and Bundibugyo virus (BDBV) are considered the deadliest. The vaccine, Ervebo, was shown to rapidly protect humans against Ebola disease, but is indicated only for EBOV infections with limited cross-protection against other filoviruses. Whether multivalent formulations of similar recombinant vesicular stomatitis virus (rVSV)–based vaccines could likewise confer rapid protection is unclear.

Methods

Here, we tested the ability of an attenuated, quadrivalent panfilovirus VesiculoVax vaccine (rVSV-Filo) to elicit fast-acting protection against MARV, EBOV, SUDV, and BDBV. Groups of cynomolgus monkeys were vaccinated 7 days before exposure to each of the 4 viral pathogens. All subjects (100%) immunized 1 week earlier survived MARV, SUDV, and BDBV challenge; 80% survived EBOV challenge. Survival correlated with lower viral load, higher glycoprotein-specific immunoglobulin G titers, and the expression of B-cell–, cytotoxic cell–, and antigen presentation–associated transcripts.

Conclusions

These results demonstrate multivalent VesiculoVax vaccines are suitable for filovirus outbreak management. The highly attenuated nature of the rVSV-Filo vaccine may be preferable to the Ervebo “delta G” platform, which induced adverse events in a subset of recipients.

The genera Marburgvirus and Ebolavirus (family Filoviridae) consist of virus members known to cause lethal hemorrhagic disease in humans and nonhuman primates (NHPs), including Marburg virus (MARV), Ebola virus (EBOV), Sudan virus (SUDV), and Bundibugyo virus (BDBV). All 4 viruses are World Health Organization high-priority category A pathogens [1] and US Centers for Disease Control and Prevention (CDC) tier 1 select agents [2], with case fatality rates ranging from approximately 23% to 90%, 39% to 90%, 34% to 65%, and 32% to 34% of confirmed cases, respectively [3, 4].

While substantial progress has been made toward the development of vaccines against EBOV such as the US Food and Drug Administration-approved vaccine Ervebo, no licensed vaccines or therapeutics are indicated for MARV, SUDV, or BDBV. Recent outbreaks of SUDV and MARV prove that non-EBOV filoviruses are also eminent threats to public health [5–7]. During the 2013–2016 West Africa and 2018–2020 Democratic Republic of Congo EBOV outbreaks, reactive vaccination with Ervebo prevented disease in 97.5%–100% of individuals immunized within 7–10 days [8, 9], demonstrating the rapid immunostimulatory properties of recombinant vesicular stomatitis virus (rVSV)–based vaccines. For an outbreak scenario, an ideal vaccine would similarly elicit fast-acting protection but also provide broad protection against multiple MARV and EBOV lineages.

Highly attenuated VesiculoVax vaccines exhibit low reactogenicity and high immunogenicity in humans [10]. The VesiculoVax platform incorporates nonreversible genetic modifications into the rVSV prototype (rVSVN4CT1) that synergistically attenuate the virus and provide a vector that is safe for human use. Previous studies indicate multivalent VesiculoVax vectors as preventative vaccines fully protect against filovirus disease in NHPs when administered 4 weeks after prime [11] or boost [12]. At shorter intervals, a monovalent VesiculoVax vector expressing MARV glycoprotein (GP) was shown to fully protect cynomolgus macaques from lethal Marburg disease when administered 1 week before virus exposure but was less effective when given at 3 days [13]. To determine whether multivalent formulations could similarly provide rapid protection, here we evaluated the ability of a blend of individual VesiculoVax vaccine constructs (rVSV-N4CT1-AMARV GP1, rVSV-N4CT1-EBOV GP1, rVSV-N4CT1-SUDV GP1, and rVSV-N4ΔG-BDBV GP1) to protect against MARV, EBOV, SUDV, and BDBV, respectively, when administered 1 week before challenge. Our results show that multivalent VesiculoVax vaccines also confer swift protection against filovirus disease, indicating their utility for outbreak response.

METHODS

Ethics Statement

Animal studies were conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals. All experiments adhered to principles stated in the eighth edition of the Guide for the Care and Use of Laboratory Animals (National Research Council, 2011). The Galveston National Laboratory where this research was conducted is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International and has an approved Office of Laboratory Animal Welfare assurance (no. A3314-01). Animal studies were performed in biosafety level 4 biocontainment at the University of Texas Medical Branch (UTMB), and protocols were approved by the UTMB Institutional Animal Care and Use Committee as well as the Institutional Biosafety Committee.

Generation of rVSV Vaccine Vectors

Expression cassettes encoding human immunodeficiency virus (HIV) gag protein, or each of the 4 full-length GPs from MARV-Angola, EBOV-Kikwit, SUDV-Gulu, and BDBV-Uganda variants, were cloned into plasmids containing the full-length vesicular stomatitis virus (VSV) genome to produce rVSVN4CT1-HIVgag or rVSV-N4CT1-AMARV GP1, rVSV-N4CT1-EBOV GP1, rVSV-N4CT1-SUDV GP1, and rVSV-N4ΔG-BDBV GP1, respectively. The HIV gag gene or each filovirus GP was expressed from the first genomic position from the single 3′ proximal promoter site to maximize GP antigen expression. Each plasmid encoded for a VSV N1-to-N4 gene translocation; shuffling the rVSV nuceloprotein (N) from the first to the fourth gene markedly diminishes the intracellular abundance of this protein by virtue of its increased distance from the 3′ proximal promoter site [14]. Other than the “delta G” rVSV-N4ΔG-BDBV GP1 vector, all vaccines also contained a VSV glycoprotein cytoplasmic tail domain (G CT1) truncation. Overall, these modifications enable robust attenuation of the vector while retaining high immunogenicity. Vectors were recovered from Vero cells after electroporation with each plasmid along with VSV helper plasmids. The rescued virus was subsequently plaque purified and amplified to produce virus seed stocks. Vaccine vectors were purified and concentrated for in vivo experiments. Before proceeding to in vivo studies in NHPs, the vector genomes were sequenced to verify the fidelity of open reading frames (ORFs).

Challenge Viruses

The MARV (variant Angola) seed stock originates from the serum of an 8-month-old female patient who died during the 2004–2005 Uige, Angola, outbreak (DQ: 447653.1). The p2 challenge material was created by passage of the original isolate 200501379 twice onto Vero E6 cells (American Type Culture Collection CRL-1586). The first passage at UTMB consisted of inoculating CDC 810820 at a multiplicity of infection (MOI) of 0.001 onto Vero E6 cells. The EBOV (variant Kikwit) seed stock originates from a 65-year-old female patient who died on 5 May 1995. The challenge material was derived from the second Vero E6 passage of EBOV isolate 199510621. The first passage at UTMB consisted of inoculating CDC 807223 (passage 1 of EBOV isolate 199510621) at an MOI of 0.001 onto Vero E6 cells. Deep sequencing indicates that this is a highly lethal 98% 7-U stock (consecutive stretch of 7 uridines).

The SUDV (variant Gulu) seed stock originates from a 35-year-old male patient who died on 16 October 2000. The challenge material was derived from the second Vero E6 cell passage of SUDV isolate 200011676. The first passage at UTMB consisted of inoculating CDC 808892 (CDC passage 1 of SUDV isolate 200011676) at an MOI of 0.001 onto Vero E6 cells. The BDBV seed stock originates from a fatal human case in western Uganda during the outbreak in 2007 [15]. The challenge material was derived from the second Vero E6 passage of BDBV isolate 200706291. The first passage at UTMB consisted of inoculating CDC 811250 (passage 1 of BDBV isolate 200706291) at an MOI of 0.001 onto Vero E6 cells. The viral GP from this stock was Sanger sequenced across the GP editing site, and it was confirmed that the sequence from bases 6900 to 6907 was wild-type BDBV (accession no. NC 014373.1). For each virus, the cell supernatants were harvested and stored at −80°C as approximately 1-mL aliquots. All virus stocks were certified free of endotoxin (<0.5 endotoxin units/mL) and mycoplasma contamination.

Animal Challenge

Twenty-four cynomolgus macaques (Macaca fascicularis of Asian origin (PreLabs; Worldwide Primates; Envigo)—8 female and 16 male, ranging in age from approximately 2.3 to 6.3 years and weighing approximately 2.1–7.6 kg—were used for 4 separate studies at the Galveston National Laboratory. Seven days before filovirus exposure, macaques were immunized with a single intramuscular injection of rVSV-Filo VesiculoVax quadrivalent vaccine (40 million plaque-forming units PFUs] or approximately 10 million PFUs per rVSV-N4CT1-AMARV GP1, rVSV-N4CT1-EBOV GP1, rVSV-N4CT1-SUDV GP1, and rVSV-N4ΔG-BDBV GP1 vaccine vector). Four animals were immunized with an identical dose of rVSVN4CT1-HIVgag at each respective time point to serve as nonspecific controls for each virus challenge. The vaccine inoculation was equally distributed between the left and right quadriceps. All macaques were challenged intramuscularly in the left quadriceps with a uniformly lethal 1000-PFU target dose of MARV-Angola (study 1), EBOV-Kikwit (study 2), SUDV-Gulu (study 3), and BDBV-Uganda (study 4). The actual doses were 1038, 1075, 963, and 1388 PFUs, respectively.

An internal scoring protocol was implemented to track disease progression in challenged animals [11, 12]. Animals were checked at least twice daily for scoring criteria such as behavior and posture/activity level (score, 0–9), appetite (score, 0–2), respiration (score, 0–9), and the presence of hemorrhagic manifestations (score, 0–9). Subjects that reached a clinical score ≥9 were promptly euthanized with a pentobarbital solution. The end point for each study was either 28 or 35 days after filovirus challenge, depending on biosafety level 4 space scheduling.

Blood Sample Collection

Blood samples were collected by venipuncture into ethylenediaminetetraacetic acid (EDTA) and serum tubes before challenge and 3, 6, 10, 14, 21, and 28 days post infection (DPI), or terminally (also at 35 DPI for subjects challenged with MARV or BDBV). A 100-μL aliquot of EDTA-treated whole blood was diluted with 600 μL of AVL inactivation buffer (Qiagen), and RNA was extracted using a viral RNA (vRNA) mini-kit (Qiagen), according to the manufacturer's instructions. To isolate plasma and serum, tubes were spun at 2500 rpm for 10 minutes at 4°C; EDTA plasma and serum were stored at −80°C for subsequent analysis.

Hematology and Clinical Chemistry

Total white blood cell counts, white blood cell differentials, red blood cell counts, platelet counts, total hemoglobin concentrations, hematocrit values, mean cell volumes, mean corpuscular volumes, and mean corpuscular hemoglobin concentrations were analyzed from blood collected in tubes containing EDTA, using a laser-based hematologic analyzer (VetScan HM5). Serum samples were tested for concentrations of alanine aminotransferase, alkaline phosphatase, γ-glutamyltransferase, aspartate aminotransferase, albumin, amylase, glucose, total protein, cholesterol, total bilirubin, creatine, serum urea nitrogen, and C-reactive protein (CRP) using a Piccolo point-of-care analyzer and Biochemistry Panel Plus analyzer discs (Abaxis).

Viral Load Determination

One-Step Probe reverse-transcription quantitative polymerase chain reaction (RT-qPCR) kits (Qiagen) and CFX96 system/software (BioRad) were used to determine viral copies in samples. Integrated DNA Technologies synthesized all primers and Life Technologies customized the probes. Probes targeting the VP30 gene of EBOV, the L gene of SUDV, the NP gene of MARV, and the VP35 intergenic region of BDBV were used for RT-qPCR analysis with the following probes: EBOV, 6-carboxyfluorescein (FAM)-5′CCGTCAATCAAGGAGCGCCTC 3′-6-carboxytetramethylrhodamine (TAMRA); SUDV, 6FAM-5′CATCCAATCAAAGACATTGCGA 3′-TAMRA; MARV, 6FAM-5′CCCATAAGGTCACCCTCTTC 3′-TAMRA; and BDBV, 6FAM-CGCAACCTCCACAGTCGCCT-TAMRA.

Primers included the following: EBOV, AGC ACG ATC ATC ATC CAG AG (forward) and TAC AGT AGG AAC GCG CAC TT (reverse); SUDV, TCA AAT ATT GCA ACC AAT GCT ATG (forward) and GCA TGT AAC ATT GCG GAA TTA GG (reverse); MARV, CAG GAT CCC TTT GGC AGT TT (forward) and TAG GCT TCT CTT GCC CTT GT; and BDBV,CTG TTC CAC CAT CAC CAA AG (forward) and GAT TCC GGA AGG AAG CAA TA (reverse). The following cycle conditions were used: EBOV and BDBV, 50°C for 10 minutes, 95°C for 10 seconds, and 40 cycles of 95°C for 10 seconds and 57°C for 30 seconds; SUDV and MARV, 50°C for 10 minutes, 95°C for 10 seconds, and 40 cycles of 95°C for 10 seconds and 59°C for 30 seconds. Threshold cycle values representing viral genomes were analyzed with CFX Manager Maestro Version 3.1.1517.0823 software. Representative genomes were calculated using a genome-equivalent standard. The limit of detection for this assay is 1000 copies/mL.

Infectious viral loads were determined using a standard plaque assay. Briefly, increasing 10-fold dilutions of plasma samples were adsorbed to Vero E6 monolayers in duplicate wells (200 µL), overlaid with 0.8% agarose/2× Eagle's minimum essential medium, and incubated for 6–8 days, depending on the challenge virus, at 37°C in 5% carbon dioxide. Neutral red stain was added, and plaques were counted after a 24–48-hour incubation. The limit of detection for this assay is 25 PFUs/mL.

NanoString Sample Preparation

Targeted transcriptomics was performed on blood samples from macaques, as described elsewhere [16, 17]. NHPV2_Immunology reporter and capture probe sets (NanoString Technologies) were hybridized with 3 µL of each RNA sample for approximately 24 hours at 65°C. The RNA–probe set complexes were subsequently loaded onto an nCounter microfluidics cartridge and assayed using a NanoString nCounter SPRINT Profiler. Samples with an image binding density >2.0 or <0.2 were reanalyzed with 1 or 5 µL of RNA, respectively, to meet quality control criteria.

Transcriptional Analysis

Briefly, nCounter RCC files were imported into NanoString nSolver 4.0 software. To compensate for varying RNA inputs and reaction efficiency, an array of 10 housekeeping genes and spiked-in positive and negative controls were used to normalize the raw read counts, as described elsewhere [18, 19]. Further details are provided in the Supplementary Materials.

Immunoglobulin M and G Enzyme-Linked Immunosorbent Assay

Filovirus GP-specific immunoglobulin (Ig) M and IgG antibodies were quantified by means of enzyme-linked immunosorbent assay performed on serum samples collected on the indicated blood collection days, as described elsewhere [17]. Further details are provided in the Supplementary Materials.

Statistical Analysis

Statistical analysis for survival was performed using GraphPad Prism software, version 9.3.1 (GraphPad Software)m using Fisher exact test. A multiple-hypothesis Benjamini-Hochberg false discovery rate–corrected P value <.05 was deemed significant for transcriptional analyses, unless otherwise stated.

RESULTS

The vaccine vectors rVSV-N4CT1-AMARV GP1, rVSV-N4CT1-EBOV GP1, rVSV-N4CT1-SUDV GP1, and rVSV-N4ΔG-BDBV GP1 were blended together at a 1:1:1:1 ratio to generate rVSV-Filo VesiculoVax quadrivalent vaccine (Figure 1A). To test whether this vaccination formulation confers rapid protection against filovirus disease, 24 macaques were immunized with rVSV-Filo or an irrelevant vector control (rVSVN4CT1-HIV-gag1) 7 days before exposure to approximately 1000 PFUs of MARV-Angola (n = 6), EBOV-Kikwit (n = 6), SUDV-Gulu (n = 6), or BDBV-Uganda (n = 6). For each challenge virus cohort, subjects either received a single intramuscular dose of rVSV-Filo (40 million PFUs) (n = 5) or a vector control (n = 1).

For the MARV challenge experiment, the MARV vector control (MC) met euthanasia criteria at 6 DPI; all vaccinated subjects (M1, M2, M3, M4, and M5) survived to the 35-DPI study end point (Figure 1B and Supplementary Table 1). For the EBOV challenge experiment, the EBOV vector control (EC) met euthanasia criteria 6 DPI (Figure 1B and Supplementary Table 2); a single vaccinated subject (E2) developed similar clinical signs (Supplementary Table 2) as the vector control and was euthanized at 9 DPI. All remaining immunized animals (E1, E3, E4, and E5) survived to the 28- DPI study end point. For the SUDV challenge experiment, the SUDV vector control (SC) met euthanasia criteria 8 DPI (Supplementary Table 3); all vaccinated animals (S1, S2, S3, S4, and S5) survived to the 28-DPI study end point (Figure 1B and Supplementary Table 3).

For the BDBV challenge study, the BDBV vector control (BC) met euthanasia criteria 11 DPI; all vaccinated subjects (B1, B2, B3, B4, and B5) survived to the 35-DPI study end point (Figure 1B and Supplementary Table 4). Therefore, immunization with rVSV-Filo afforded 100%, 80%, 100%, and 100% protection against MARV, EBOV, SUDV, and BDBV, respectively. For each virus challenge, survival in vaccinated subjects was statistically significant compared with historical cynomolgus macaques (these served as naive controls in various published and unpublished vaccine and therapeutic studies) [16, 17, 20–26]. The corresponding P values were <.001 for MARV, EBOV, and SUDV and .004 for BDBV challenges (Fisher exact test, 2 tailed).

In fatal cases, including the vector controls (MC, EC, SC, and BC) and the single nonsurviving vaccinated subject (E2), animals developed signs consistent with filovirus disease including fever, anorexia, and petechial rash (Supplementary Tables 1–4). As expected in these models, serum levels of liver-associated enzymes and kidney function products indicative of organ damage (ie, alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, γ-glutamyltransferase, serum urea nitrogen, and creatine) were elevated in fatal cases (Supplementary Tables 1–4). Poor outcomes were also correlated with elevated CRP levels, along with thrombocytopenia, lymphopenia, and neutrophilia.

All survivors remained healthy other than 1 SUDV-challenged macaques (S3) that was briefly anorexic at 11 DPI and 2 EBOV-challenged macaques (E1 and E4) that exhibited anorexia and developed a mild petechial rash (Figure 1C and Supplementary Table 2). Other clinical signs in subject E4 included hunched posture (11–21 DPI), weakness (15–28 DPI), coordination difficulties (15–28 DPI), and dermatitis of the tail and extremities (19–28 DPI) (Figure 1C and Supplementary Table 2).

Various hematologic changes in survivors were also detected over the course of the study along with CRP increases in several subjects (M1, M2, E1, E4, S2, S4, and B3) (Supplementary Tables 1–4). In particular, subject E4 had an elevated white blood cell count and increased CRP values that persisted to the study end point, indicating a potential secondary bacterial infection, which has previously been reported in filovirus-infected humans and macaques [27–30]. Notably, this subject exhibited genital lymphedema before vaccination and subsequent challenge with EBOV but had no gross evidence of fulminate EBOV disease at the study end point.

Viral titers were assessed in each experiment by performing RT-qPCR amplification of vRNA and conventional plaque assays. Infectious virus was detected only in fatal cases (E2 and vector controls MC, EC, SC, and BC) ,with end-stage titers peaking at approximately 8 (MC, EC, and SC) and 5 (BC and E2) log₁₀ PFUs/mL (Figure 2A). The corresponding vRNA end-stage titers peaked at approximately 12 (MC, EC), 11 (SC, BC), and 9 (E2) log₁₀ copies/mL in macaques that died (Figure 2B). The absence of detectable viremia in animal E4 at any time further suggests a secondary bacterial infection in this subject. Low levels of vRNA (approximately 5 log₁₀ copies/mL) were transiently detected in 2 SUDV-exposed subjects (S2 and S3) at 6 DPI, but the virus was cleared by the next time point (10 DPI). Survival was correlated with vRNA levels approximately 2–5 log₁₀ copies/mL lower in various tissues (Supplementary Figure 1).

While the primary focus of this study was to determine vaccine efficacy, we also performed targeted transcriptomics on whole-blood RNA from filovirus-exposed macaques at 0, 3, and 6 DPI to identify immunologic trends associated with rVSV-Filo–mediated protection. Dimensionality reduction via principal component analyses indicated RNA samples predominantly clustered independently of virus and group, but dimensional separation was observed for disposition (death or survival) and DPI covariates (Supplementary Figure 2). In contrast to samples from fatal cases, survivor samples exhibited minimal time point–distinct clustering, except for BDBV survivor samples, which tended to cluster away from MARV, EBOV, and SUDV samples, denoting transcriptional variation in these subjects.

Vaccinated versus vector control subjects expressed higher levels of transcripts associated with antigen presentation (HLA-DMB, HLA-DPB1, HLA-DRB1, HLA-DQA1, and HLA-DRA), granzyme production (GZMH, GZMA, GZMM, and GZMK), innate lymphoid cell and cytotoxic cell activation and recruitment (CD8A, KLRK1, KLRC3, TBX21, ZAP70, and CD3G), and B-cell–associated signaling (CD1C, CD79A, CD79B, and MS4A1) (Figure 3A and Supplementary Data 1). Conversely, reduced expression was observed for transcripts associated with inflammation (CXCL10, CCL3, IL6, and TNFAIP6) and innate immunity signaling (OAS1, IFIT2, MX1, IFI44, and OAS2), as well as messenger RNAs encoding the calcium-binding heterodimer calprotectin (S100A8 and S100A9), in survivors. The top up-regulated pathways in vaccinated subjects were involved in adaptive immunity and immunoregulation (eg, adaptive immune response, positive regulation of immune response, B-cell receptor signaling pathway, and humoral immune response), whereas the most down-regulated transcripts enriched to innate immunity and inflammation pathways (eg, innate immune response, myeloid leukocyte activation, response to virus, and inflammatory response) (Figure 3B).

As expected, overall expression changes in samples from survivors versus fatal cases coincided with transcriptional profiles exhibited by MARV, EBOV, SUDV, and BDBV survivor groups at 6 DPI, including up-regulation of CD1C, HLA-DQA1, IBKAP, CD8A, GZMM, IL7R, and HLA-DOB and down-regulation of OAS1, CXCL10, CCL3, and TNFAIP6 (Figure 3C). To capture shifts in circulating cell populations associated with survival, we conducted nSolver-based immune cell type profiling. In accordance with our hematology and differential expression results, survival was correlated with higher frequencies of natural killer, T, and B cells and lower frequencies of neutrophils, macrophages, CD45 cells, and natural killer CD56^dim cells (Figure 3D).

Finally, we measured serum antibody levels. Only minimal IgM titers were noted throughout the study, with first detection of antibodies in immunized subjects at 0–3 DPI (7–10 days after vaccination) (Figure 4A). Interestingly, the BDBV control (BC) generated moderate IgM titers (1:800) at 10 and 14 DPI, but antibody production was substantially delayed compared with specifically vaccinated subjects. A similar trend was observed for BDBV GP-specific IgG (Figure 4B). All surviving subjects had detectable filovirus GP-specific IgG titers by 6 DPI, with peak titers ranging from 1:400 to 1:12 800.

DISCUSSION

In summary, immunization with quadrivalent rVSV-Filo VesiculoVax vaccine provides rapid protection against filoviruses within 7 days. Specifically, 5 of 5 immunized subjects survived MARV, SUDV, and BDBV exposure, and 4 of 5 survived EBOV exposure. In contrast, all vector controls (MC, EC, SC, and BC) developed characteristic filovirus disease, including high viremia, fever, anorexia, petechial rash, lymphopenia, thrombocytopenia, and neutrophilia. Impressively, this prophylactic window of 7 days afforded similar protection compared with monovalent VesiculoVax formulations [13]. This time frame is also consistent with Ervebo, which prevented disease in humans within 7–10 days after ring vaccination. Thus, the rVSV-Filo VesiculoVax vaccine may be suitable for outbreak response.

While the exact mechanism for rVSV-mediated fast-acting protection is not entirely understood, our transcriptomic data support B cells, innate lymphoid cells, and cytotoxic cells are strongly implicated in disease resistance. Based on our serologic data, the humoral response is also involved in filovirus disease resistance. One limitation of our transcriptomic analysis is that vaccinated subjects were combined into a single group and compared against a single vector control at each time point (0, 3, and 6 DPI) for each virus challenge. For the analysis comparing survivors and fatal cases, all samples were combined irrespective of timing after infection (0, 3, or 6 DPI) or group (vaccinated or vector control). These factors may have introduced bias into our interpretation. Nevertheless, these protective correlates are in line with previous findings in various rVSV-based vaccines against several viral diseases [31–37].

In phase I clinical evaluation, a monovalent formulation of an EBOV VesiculoVax vaccine was well tolerated and immunogenic in humans (https://clinicaltrials.gov/ct2/show/NCT02718469) [10]. The vaccine elicited robust EBOV GP-specific IgG responses in humans and modest but balanced cellular immune responses. Importantly, incidents of vaccine shedding, skin conditions, or arthritis were not reported in vaccinees at any dose tested, including those given a high (18 million–PFU) dose. In contrast, delta G vaccines, such as Ervebo were shown to induce arthritis, maculopapular or vesicular rashes, and cutaneous vasculitis in some recipients [38, 39]. While these adverse events were not classified as contraindications, a less reactogenic vaccine would likely be preferred for widespread vaccination. In conclusion, these data support the evaluation of quadrivalent rVSV-Filo VesiculoVax in phase I clinical trials as the next step in developing a safe and effective panfilovirus vaccine suitable for outbreak response.

Supplementary Data

Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.

Notes

Acknowledgments. The authors thank the University of Texas Medical Branch Animal Resource Center leadership and staff, including Matt Hyde, Gregory Kraft, and Margaret Comeaux for laboratory animal support.

Author contributions. C. W., R. W. C., J. H. E., D. M., and T. W. G. conceived and designed the study. D. M. conceived and designed the vaccine vectors and, together with C. G. and N. M., generated and characterized all vaccine candidates. D. J. D. and R. W. C. performed the animal challenge experiments. C. W., K. N. A., M. B. H., A. N. P., D. J. D., R. W. C., and T. W. G. performed the animal procedures and clinical observations. V. B. and K. N. A. performed the clinical pathology assays. V. B. performed the plaque assays. K. N. A. performed the polymerase chain reaction assays. R. O. performed the immunoglobulin M and G enzyme-linked immunosorbent assays. C. W. performed the transcriptomics assays. K. A. F. performed the animal necropsies. All authors analyzed the data. C. W. wrote the manuscript, and T. W. G. edited it. All authors had access to the data and approved the final version of the manuscript.

Disclaimer. Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the University of Texas Medical Branch.

Financial support. This study was supported by the National Institutes of Health (grant U19AI142785 to T. W. G.) and by the National Institute of Allergy and Infectious Diseases, National Institutes of Health (grant UC7AI094660 supporting biosafety level 4 operations at the Galveston National Laboratory, University of Texas Medical Branch).

Supplement sponsorship. This article appears as part of the supplement “10^th International Symposium on Filoviruses.”

Data availability. Data available in the Supplementary Materials.

References

Author notes