An error appeared in an electronic article in the 15 October 2003 issue of the journal (Myjak P, Nahorski W, Pietkiewicz H, von Nickisch-Rosenegk M, Stolarczyk J, Kacprzak E, Felczak-Korzybska I, Szostakowska B, Lucius R. Molecular confirmation of human alveolar echinococcosis in Poland. Clin Infect Dis 2003; 37:e121–5). Reference [12] should appear at the end of the penultimate sentence in the first paragraph of the “Molecular examinations” subsection of Materials and Methods (p. e121). The sentence should read, “A fragment of mitochondrial 12S rDNA was amplified by PCR (AmpliTaq Gold polymerase; Applied Biosystems) from human genomic DNA using the cestode-specific primers 60 (forward, TTAAGATATATGTGGTACAGGATTAGATACCC) and 375 (reverse, 5′-AACCGAGGGTGACGGGCGGTGTGTACC-3′) [12].” The journal regrets this error.